you're reading...
evolution, science

DNA is Not a Code

Ok, yes it is… sort of.

There’s been a rather tired argument making its way around the theist blogosphere of late, arguing that DNA is a code, and codes are designed things.  The very fact of it being a code proves that there must have been someone who designed the code.

As usual, this argument comes down to using words improperly.  A code, by the strictest definition, is in fact something designed by intelligent beings.  It is a system of symbols that either arbitrarily or by some system represent various things.  The alphabet I’m using to write this blog is a code.  There’s nothing about the individual letters that have any inherent meaning.  They don’t do anything in and of themselves.  By agreement between multiple humans, we have a legend, or a key, which most of us learned in grammar school.  By using this legend, we can look at anything in the code “English” and through substitution, come to the knowledge of the concepts sybolized by the various letters.

This is the traditional idea of a code, and it is what theists think they mean when they argue that DNA is a code.  The thing is, DNA is not that kind of a code.  DNA is a a polymer, which is composed of individual chemical units called nucleotides.   There are four types of these nucleotides, and we humans have decided to call them adenine, guanine, cytosine, and thymine.  These names are not entirely arbitrary, but in the end, there’s nothing magical about them.  We could call them Blob, Clob, Dob, and Emu, and they’d still be the same.  Our language — the code we humans use to communicate — is just a way for us to give each other information and keep things separate in our own minds.

The nucleotides in DNA are often said to be the “blueprints” or “code” which define a sequence of messenger RNA which in turn defines at least one protein.  In a sense, these proteins are the building blocks of life, and DNA is the “code” which determines the qualities of the life that will be built.

The problem with the theist argument, however, is that the DNA code is not arbitrary, and it does not rely at all on the agreement of sentient beings.  In fact, it is exactly the same in nature as any other dynamic chemical process.  When you see an explosion on TV, you’re watching a chemical reaction that was controlled by the same kind of “code.”   Crystals grow based on such a code.  Stars give off light and energy from the same kind of code.

All DNA is, to the chagrin of creationists, is a very, very complicated organic molecule that can react in a staggeringly large number of ways with other organic molecules.  Unlike an explosion or a crystal, which can be described mathematically with a few simple formulas, the process of building a living thing is several orders of magnitude more complicated.  It takes perhaps 10 billion bits to convey all the necessary information needed to build a human, and the process is never really finished until the human dies, so we’re talking about a very, very long process by comparison with an explosion, and billions more unique steps than the formation of a crystal.

Yet, it’s the same process.  This molecule, when in the presence of that molecule, will bond and make this new molecule.  It’s just chemistry.

The thing is, we humans recognize the complexity of the chemical process we call life, and we notice that it is not completely dissimilar from the process by which we build a skyscraper or a watch.  We have a set of instructions, and we refer back to them throughout the whole process of putting materials together in very specific ways, until we have a finished product.  We like to argue that messenger RNA is “referring to the instructions” to figure out which protein to build in the same way, but it’s not.  Neither DNA nor RNA is sentient.  They are both just doing what chemicals do.  DNA is more akin to a catalyst than a set of instructions.  That is, the DNA stays essentially the same throughout the building process, but it is facilitating chemical reactions the whole time it is part of a living thing.

So, here is the ultimate problem with this particular theist argument.  DNA is not an arbitrary set of symbols that “stand for” something else that will be interpreted through some kind of a legend.  It is a set of chemicals which are nonthinking, and have no choice but to do what they do, in the same way that a crystal has no choice but to grow when in the presence of the appropriate aqueous solution.  DNA is just a very, very, very complicated molecule that happens to be capable of facilitating incredibly complex sets of chemical reactions.

Sure, it seems magical that something as simple as four little nucleotides could be responsible for all the diverse life on the planet, but our sense of wonder at the versatility of carbon shouldn’t woo us into the false belief that incredible versatility is equivalent to design.  DNA is not a “code” in the normal sense of the word.  We call it a code because doing so gives us an easy way to think of the process by which a strand of DNA is responsible for the building of a living thing.

That’s it.  When we look at a particular sequence of nucleotides, we can recognize that the chemical reaction they facilitate will produce a certain protein.  This is no different from looking at a few grams of sodium or potassium and recognizing that in the presence of water, they will react in very specific ways to produce a violent exothermic reaction.  If DNA is a code, then so is every other molecule in the universe.  It’s just the consistency of the laws of nature.  This, in the presence of that, will do the other.

So no, DNA is not a code.  It is analogous to a code in enough ways that it makes sense for us to refer to things like the “genetic code,” but in the end, we’re just not talking about the kind of code that would make the theist argument valid.  Sorry, theists, but you fail on this one, too.

add to del.icio.us :: Add to Blinkslist :: add to furl :: Digg it :: add to ma.gnolia :: Stumble It! :: add to simpy :: seed the vine :: :: :: TailRank :: post to facebook

Advertisements

Discussion

187 thoughts on “DNA is Not a Code

  1. Your musings are just that. You make statements of fact without support or evidence. The code of DNA is just that. Your simple objections are based on belief, not facts. Actually you could of made your entire argument much more concise. Here is an example; DNA ain’t code cause’ if I agreed it wus, at’ woud hep that evil theist.

    Get a life brother. ; {>

    Posted by RevPhd | November 2, 2009, 7:45 am
  2. I like your explanation. It states the facts as they are.
    Most of us fail to realize we have a very limited way of expressing ourselves with language, and language gets in the way.

    I am surprised this article hasn’t had more antagonistic responses from the Religious groups.

    Science will eventually debunk all the “mysteries,” but life will always remain a mystery.
    And a gift.
    Peace

    Posted by George | December 29, 2009, 6:35 am
  3. RevPhd,

    You most likely won’t come back to read this, but I’d like to say: you are so far off, you aren’t even wrong.

    Hamby specifically laid out the reasons why DNA is not a code in the same way that language is a code. What part did you miss? The part where DNA is part of a chemical reaction, not significantly different from combustion (which is certainly not a code)?

    Chemical reactions are not code. DNA transcription is strictly a set of chemical reactions. It’s a very complex set of chemical reactions, to be sure; but complexity is not evidence of design, the theists’ inability to grasp naturally-occurring complexity notwithstanding.

    So, to sum in your style: you simply are saying, “Oh noes! He’s trying to explain how DNA is not like other codes such as language! La-la-la-la! I can’t hear you!”

    Posted by Anthony Taylor | December 29, 2009, 2:03 pm
  4. Straightforward, clear, and concise. This is a great article for those who can’t understand why this ID argument fails.

    Posted by Dervish | February 22, 2010, 1:42 am
  5. DNA is a literal code as defined under Shannons communication model. That is a universally accepted scientific fact.

    Anyone who takes the time to independantly research the subject will arrive at the same conclusion.

    Start with Yockey, perhaps the worlds formost scientist in Bioinformatics :
    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    Posted by PG | March 15, 2010, 10:36 pm
  6. So… what’s your point? That DNA is a code, but that the definition is broader than the one I gave, so it’s still an equivocation?

    Or are you saying that because Yockey says its ok to call DNA a code that God exists?

    I’m confused.

    Posted by hambydammit | March 17, 2010, 12:47 pm
  7. The equivocation is to suggest that DNA is not really a code.

    DNA is a literal code and not simply a metaphor, or analogy, but is a literal code as verified by scientific method. All Biology textbooks, Medical Dictionary’s, and Peer Reviewed scientific literature reflect these findings. In fact The entire scientific field of Bioinformatics is based on DNA being a literal code and not simply a metaphor or analogy. It meets all strict requirements of Gitts and Shannons Communication Models. In addition, it meets the definition of langauge as defined by Zipf’s law.

    Google: The language of DNA or Genetic code.

    The implications are enormous. Here is the syllogym:
    1) DNA is a literal code (A scientific fact)
    2) All known codes are designed. (A repeatable observation )
    3) DNA is proof of design.

    All the Materialists needs is one example of a naturally occuring code to topple the proof…
    Bioinformatic’s is deseprately trying to find that ellusive natural solution, but ultimately what that would require is for them to find a yet unknown natural law capable of violating existing natural laws.
    However, they are in total agreement on this fact:
    They do not share your opinion that DNA is simply complex chemical reactions and not a literal code as you suggests.

    .

    Posted by PG | March 17, 2010, 3:16 pm
  8. The implications are enormous. Here is the syllogym:
    1) DNA is a literal code (A scientific fact)
    2) All known codes are designed. (A repeatable observation )
    3) DNA is proof of design.

    Bleh. And here I thought you had something useful to say. No, #2 is not correct. It’s just dead wrong. Sorry. You’re doing the whole thing ass-backwards. Even broadening the definition of “code” to include DNA (which is fine with me) we would have to include lots of things that aren’t “designed” in a way that’s meaningful to the ID argument. Not to mention that it’s pretty damned presumptuous to include DNA as one of the designed codes in the argument to prove that DNA is designed.

    That’s called a circular argument.

    Posted by hambydammit | March 17, 2010, 3:33 pm
  9. 1) DNA is a literal code. Science has defined it as a literaL code whether your fine with it or not! ; )

    You state that #2 “All known codes are designed” is not correct.

    To be incorrect,you must provide empirical evidence of a naturally occuring code( as rigorously defined in science)

    Posted by PG | March 17, 2010, 5:32 pm
  10. PG, I’m going to do this exactly one time, and that’s it, because I’ve already explained this in great detail in the post itself.

    The word “code” in an argument accomplishes nothing unless it has a specific definition that has a real referent. The real referent in the statement “DNA is a code” is something like this: “A set of information that correlates to specific causal relationships.” While it’s trivially true that there is a definition of “code” under which DNA falls, it is not helpful to the ID argument, since the referent in that argument is something like this: “A set of information that was designed to correlate to specific causal relationships.”

    The problem with “2) All known codes are designed” is that it fails on two levels.
    1) It is tautological. “All codes that have been designed are designed” is trivially true, but useless in this argument. And it is unsupported. In a sense, (2) and (3) are saying the same things, and are not proper steps in an argument.
    2) Supposing that (2) was indeed true, it does not lead logically to (3). That’s basic logic. It might suggest that all codes are designed, but it doesn’t prove it.

    Furthermore, as I already said, proving that DNA is designed is necessary for proposing (2). And since this argument is designed to prove that DNA was designed… well… that’s a circular argument.

    Finally, if we are extending the definition of code to the very broad one you referenced, then there are millions of codes all over the place that are clearly not designed. Unless, of course, you presume that there is a creator of the universe, in which case, you’ve gone into another circular argument.

    So anyway, nice try, but it’s the same old dog chasing its tail.

    Posted by hambydammit | March 17, 2010, 7:05 pm
  11. Hambydammit,
    You state “DNA is not a code”.
    I assert that you present an incorrect statement that is counter to present scientific understanding and is not based on any empirical evidence presented in any peer reviewed Scientific publications. Your assumptions about ” DNA is not a code” is simply your opinion and not based on any known scientific convention.

    My original post defines DNA as a literal code as under the specific and rigourous definition from Shannons and Gitts communication model. I can present mountains of peer reviewed scientific literature that disproves your position. Science has proven DNA to be a literal code. It is a complex communication system with encoder to decoder processes. It is also a language that meets the specific and rigourous definitons under Zipf’s law.

    In addition,As I stated earlier, there are no known “Naturally occuring” codes that meet the specific and rigourous definition of Shannons communication model. Does any of your millions of examples have an encoder to decoder process? Let me answer this for you. No they do not! Your insisting that DNA is simply patterns and chemical reactions is to be considered anti-science.

    Google: “Yockey DNA Communication model” to learn why DNA is considered a literal code and refutes your position.

    Regarding #2) “All known codes are designed”
    It is a correct statement AND SUPPORTED BY repeatable scientific observation! You are incorrectly stating that natural occuring patterns and chemical reactions are inclusive in this catagory, but they are not. They do not possess a encoder to decoder process. They do not represent more than their material. For example, a snowflake …is just a snow flake with a pretty pattern. The snowflake has no information being encoded and decoded. it does not represent anything more than itself. It presents no information or instructions as does DNA.

    But here is what we do know:
    100% of known codes are designed.
    0 % of known codes occure naturally.

    Therefore, DNA is proof of design. Could science find a new natural law that defies current known natural laws? Perhaps, but then you are proposing a “Science of the gap” theory!

    So provide empirical evidence of one naturally occuring code with a encoder to decoder communication system as defined by Yockey. You stated you had millions of examples. name one, and you will win a Nobel Prize.

    Just 1…

    .

    Posted by PG | March 18, 2010, 1:31 am
  12. Hambydammit,

    Before you respond to the above posts, you need to consider the following….

    “Information is information, neither matter nor energy. Any materialism that fails to take account of this will not survive one day.”
    -Norbert Weiner, Founder of Cybernetics

    That is a profound statement. You don’t have to think about it very long to realize it’s absolutely true. Matter, Energy and Information are three Distinct Entities.

    Is the computer code separate from the computer disk material? Yes! We also know that information cannot be created without intent. There are no examples of information that is created without intent. You have to have the dimension of intent or will, which is a property of a conscience mind, in order to have any kind information. Otherwise all you have is chaos. All you have is tornadoes and hurricanes and stalactites and stalagmites and snowflakes. But you do not have any kind of language whatsoever.

    So the problem with a materialistic philosophy or belief is there is no way to explain where the language of DNA came from. Because all codes, all languages, all encoding, decoding systems come from a mind. No exceptions.

    Yockey readily admits that science cannot explain the origins of the information contained in DNA. Simply put, its like trying to scientifically prove that computer code can simply evolve from the computer disk material!

    .

    Posted by PG | March 18, 2010, 1:59 am
  13. No, “we” don’t fail at all. So you know more than Hubert Yockey on all this? Yes, “we” know he’s not a creationist.

    If you guys have to resort to the “strictest definition” to skirt around the real issues then something is amiss.

    First off, you’ve seen the quote from Yockey, the one about how code and information and messages all apply to biology. He said plainly that there is information in DNA that cannot be accounted for. We know that matter, energy and info are separate entities. Can rocks produce info? Can fractiles and chaos produce info? If they can, please point me to an observed example in nature where this has happened even once.

    Now … the first mistake you make is using the old atheist playbook move to reducing everything to just chemicals and energy bouncing around doing their thing. Before the discovery of DNA, science marveled at the incredible chain of events that happen the moment a sperm hits the egg. Things do not just act like the explosion analogy that was used. The cells are following a strict design and instructions. Every explosion is different. Things fly everywhere at random. Not so with DNA. Unless there’s a mutation (99.99% of the time a damaging one) caused by exposure to chemicals, alcohol, etc, then human babies are born with 2 arms, 10 fingers, the same incredibly intricate eyeballs, etc. Most humans hover around a typical height, again, unless there’s a mutation. If it were an “explosion,” we’d see *huge variances and massive “mutations” from the norm. Actually, there’d be no norm or typical. But there is, among every species on the planet.

    The second mistake you make is brushing off the significance of the “alphabet” of DNA. You talk about how their names make no difference. But this is a moot point. This is not just a figurative alphabet. They mean something, the same way letters lead to words which lead to sentences which lead to paragraphs, etc. Without this alphabet there’d be chaos and randomness.

    The third mistake you make is the comparison to rocks and crystals. This is a major “FAIL.” Rocks and crystals are a beautiful example of randomness. Why?, because they’re all different. “No two snowflakes are alike,” right? That’s because it’s true. Every single rock and snowflake is a unique design of random chaos. I’ve heard atheists try to say there’s “code” in rocks. Are you kidding? What is code for? It starts with an intention to transfer some kind of information to something else. If DNA were as you describe, there’d be no transfer of information that stayed consistent. There’d be no “From” and no “To.”

    Now, to your credit, you go on to describe the complexity of DNA. But, there’s more. James Shapiro’s research discovered that a cell, under duress, will splice its DNA into over 100k pieces and then re-arrange them to make the best possible fit. It uses an algorithm, not random mutation and natural selection, a process that’d take so long even 14 billion years wouldn’t be enough time. There is a formula for this. This is why so many pieces are missing from the evolution tree. This is why Gould and Eldridge had to come up with Punctuated Equilibrium as an explanation for events like the Cambrian explosion. DNA also finds errors and correct them, just like a program. Do explosions correct themselves? Do rocks and crystals correct themselves while forming? Francis Crick himself called all this a “miracle” he was so impressed with DNA.

    No, we do not fail. Its you who, some 170 years after Darwin are still trying to prove an unprovable theory.

    Posted by boledle | March 23, 2010, 2:16 pm
  14. No, “we” don’t fail at all. So you know more than Hubert Yockey on all this? Yes, “we” know he’s not a creationist.

    ~sigh~ No, I’m perfectly happy with including DNA in Yockey’s definition of “code.” It doesn’t help your case, though, because it’s not the definition of “code” that would help you. Get it?

    If you guys have to resort to the “strictest definition” to skirt around the real issues then something is amiss.

    Well, no again. That’s how science works. Strict definitions. There are a lot of words that have different meanings based on context, and in order to be scientifically accurate, we need to specify precisely which definition we mean. This is all pretty basic stuff.

    First off, you’ve seen the quote from Yockey, the one about how code and information and messages all apply to biology. He said plainly that there is information in DNA that cannot be accounted for. We know that matter, energy and info are separate entities. Can rocks produce info? Can fractiles and chaos produce info? If they can, please point me to an observed example in nature where this has happened even once.

    Yes, there is information in DNA, and science has not “accounted” for it all, meaning that we are still in the process of figuring out what all of the information means and where it originates. This is not an admission that information is magically appearing out of nowhere. Not even remotely. It’s simply noting that we have not decoded the entire thing.

    Things do not just act like the explosion analogy that was used. The cells are following a strict design and instructions. Every explosion is different. Things fly everywhere at random. Not so with DNA.

    Heh… That’s cute. Really, it is. I honestly don’t know how to respond to it. Do you know why explosions happen? When two chemicals that are highly reactive come into contact, they react. If you take water and potassium, for instance, and measure out fifty portions of each, precise down to the molecule, and run fifty precisely controlled experiments in which the two are brought together without any external interference, you’ll get fifty of exactly the same explosions. It’s just chemistry. That’s why hand grenades are all the same size, and how we can know the explosive force of a nuclear bomb without ever letting it explode. Sure, when external variables enter the equation, things can get a little unpredictable, but guess what? It’s the same with DNA.

    Embryonic development is an amalgam of “nature” and “nurture.” When we manipulate an embryo — for instance, when we take a very small hair and pinch off half of a newt embryo (this was one of the pioneering experiments in embryology, by the way) we are altering the environment, which causes changes in the way DNA expresses. (Expression means “how it reacts chemically.”) You know why mothers shouldn’t drink when they’re pregnant? Because alcohol introduced to the embryo changes the way the DNA expresses as the embryo develops. The mother, the air she breathes, the food she eats, the drugs she takes — these are all environmental variables that act on DNA in the same way that wind, heat, physical barriers, and humidity work on hand grenades.

    Unless there’s a mutation (99.99% of the time a damaging one) caused by exposure to chemicals, alcohol, etc, then human babies are born with 2 arms, 10 fingers, the same incredibly intricate eyeballs, etc. Most humans hover around a typical height, again, unless there’s a mutation. If it were an “explosion,” we’d see *huge variances and massive “mutations” from the norm. Actually, there’d be no norm or typical. But there is, among every species on the planet.

    You should take a course on embryology. Really. You have no idea how many variations there are. The mistake you’re making is in thinking that most of these huge variances will live. They don’t, primarily because the mutation takes them too far away from what works. The vast majority of gross mutations are spontaneously aborted, miscarriages, or stillborn.

    The second mistake you make is brushing off the significance of the “alphabet” of DNA. You talk about how their names make no difference. But this is a moot point. This is not just a figurative alphabet. They mean something, the same way letters lead to words which lead to sentences which lead to paragraphs, etc. Without this alphabet there’d be chaos and randomness.

    No. They do something. I’ve already explained this in the article itself. The individual components of DNA have fixed physical properties, and they react in predictable ways with other chemicals. This allows humans to describe their properties predictively. Letters and words represent concepts. DNA is part of a physical function. The two are not analogous.

    The third mistake you make is the comparison to rocks and crystals. This is a major “FAIL.” Rocks and crystals are a beautiful example of randomness. Why?, because they’re all different.

    Um…

    Jesus Christ on a pogo stick. I’ve been trying to address you intellectually but you’re making it really hard. You’re trying to suggest that every person on the planet isn’t different? Please take a minute and think about what you just said. It’s really dumb.

    Every single rock and snowflake is a unique design of random chaos.

    No, crystals have very precise structures, and their molecules are arranged in predictable ways based on their elemental properties. Just like DNA. The variations in rocks, crystals, and snowflakes are due to environmental factors such as impurities, inclusions, wind, humidity, etc.

    I’ve heard atheists try to say there’s “code” in rocks. Are you kidding? What is code for?

    Here’s an experiment you can do. Take copper sulfate. Dissolve it in water. Place a small string in the water and let it sit for a few days. You’ll have lots of “seed crystals.” Take all but one of them off and re-dissolve the rest into the solution. Repeat this procedure several times, and your seed crystal will be quite large. If you continue doing this for a long time, you’ll have something that looks like this:

    The “code” is inherent in copper sulfate crystals. If you do this experiment a thousand times under very controlled conditions, the crystal structure will be the same a thousand times. That’s because the molecules “know” what to do. Have you ever taken a Chemistry class? This is very simple stuff.

    What is code for? It starts with an intention to transfer some kind of information to something else. If DNA were as you describe, there’d be no transfer of information that stayed consistent. There’d be no “From” and no “To.”

    Ok. This is what I already explained. Humans “intend’ for things to happen with codes. It’s why we invented codes like C++ and Arabic Numerals. Neither DNA nor crystals “intend” for anything to happen. A sperm doesn’t “decide” to move through the urethra during ejaculation. It doesn’t “decide” to unite with the egg, nor does the zygote “decide” to lodge itself on the uterine wall. These processes are all unconscious chemical reactions, as are the processes of gene transcription, protein folding, and embryonic development.

    James Shapiro’s research discovered that a cell, under duress, will splice its DNA into over 100k pieces and then re-arrange them to make the best possible fit. It uses an algorithm, not random mutation and natural selection

    LOL. Yes. It is an algorithm, which is a way of describing a process, which is what a chemical reaction is. The reason it’s not natural selection is… duh… it’s not natural selection. It’s an experiment with chemicals that are part of the process of natural selection.

    This is why Gould and Eldridge had to come up with Punctuated Equilibrium as an explanation for events like the Cambrian explosion.

    ~Sigh~

    Punctuated equilibrium is NOT an alternative to natural selection. It’s a way of viewing natural selection from a different perspective. Do a little experiment really quick. Take a computer generated diagonal line and look at it from far away. It’s a smooth line, right? Now, magnify it very large, maybe a hundred times. Now it looks like stair steps, right? Because each pixel is really a square, right? And when you line up squares corner to corner diagonally, it makes stair steps. Up close… stair steps. Far away, straight line.

    That’s punctuated equilibrium vs. gradualism. It’s really that simple.

    DNA also finds errors and correct them, just like a program. Do explosions correct themselves?

    No, explosions do not have self-correcting mechanisms. They are too transient for any kind of stable structure to develop that kind of complexity. The process of “life” has been going on for billions of years. Plenty of time for complexity to develop. A few milliseconds? Simply not enough time.

    Francis Crick himself called all this a “miracle” he was so impressed with DNA.

    Oh NoEz! Francis Crick used the word “miracle!” And since the word “miracle” cannot possibly mean “something that is really freaking astounding,” I must conclude that everything science has learned in the last century is wrong. Thank you for setting me straight, Mr. Science Guy. Sheesh.

    No, we do not fail. Its you who, some 170 years after Darwin are still trying to prove an unprovable theory.

    Thank you for your contribution. It was… interesting.

    Posted by hambydammit | March 23, 2010, 3:57 pm
  15. “Information is information, neither matter nor energy. Any materialism that fails to take account of this will not survive one day.”
    -Norbert Weiner, Founder of Cybernetics

    And materialism does account for information. At least good materialism does. “Information” is a way of describing the conceptualization of qualities of matter/energy/space/time. All M/E/S/T exists as something. Being something is also not being something. In other words, to exist as something, existence must have limits. When a thing has limits, a thing becomes quantifiable.

    “One” does not exist as M/E/S/T, but it does exist as a way to conceptualize it. “One” is dependent upon mind to exist. However, the properties of M/E/S/T that lend themselves to conceptualization as “one” exist regardless of mind.

    That is a profound statement. You don’t have to think about it very long to realize it’s absolutely true. Matter, Energy and Information are three Distinct Entities.

    Well, no. Matter/Energy… general relativity…

    In physics, information is defined differently, and refers directly to the physical world. Where a lot of confusion seems to be occurring is in the conflation of this definition with that used in describing DNA as a code, which is necessarily a form of information. If we’re talking about physics, then fine. DNA, being material, is information. But speaking chemically, DNA is just… chemicals. The information about DNA is the conceptualization and quantification of these chemicals in the minds of observers.

    Is the computer code separate from the computer disk material? Yes! We also know that information cannot be created without intent.

    Within the physics definition, yes. Information equals intent. But this is not the usage in the conversation about DNA. This is really, really simple. Two definitions. One applies. The other one doesn’t.

    So the problem with a materialistic philosophy or belief is there is no way to explain where the language of DNA came from. Because all codes, all languages, all encoding, decoding systems come from a mind. No exceptions.

    LOL… yes. There is a way to explain where the “language” of DNA came from. It’s chemical reactions. It’s predictable, regular occurrences of the same physical processes. This molecule bonds with that molecule because of the properties of the electron clouds in its component atoms. It does so in exactly the same way every time, given the same conditions. This is absolutely no different than any other chemical reaction. We use language to describe this process in a predictive manner. For convenience, we happen to use letters to represent the four chemical components of DNA, each of which reacts in unique and predictable ways with other chemicals.

    Simply put, its like trying to scientifically prove that computer code can simply evolve from the computer disk material!

    No, it isn’t. There is no natural selection in computer codes. Computer codes are not replicators. We can create replicators and selection parameters with computer codes, but the codes themselves are not replicators, and hence there is no selection. That’s the fundamental difference.

    Posted by hambydammit | March 23, 2010, 6:19 pm
  16. Darn, You wrote so much yet as I continued to read it became disappointingly clear that these are simply your opinions with absolutely no peer reviewed publications to support your claims.

    Why is that important?

    A world renowned Scientists states that information is seperate from the medium:
    “Information is information, neither matter nor energy. Any materialism that fails to take account of this will not survive one day.”
    -Norbert Weiner, Founder of Cybernetics

    Your Response:
    ” Well, no. Matter/Energy… general relativity”
    – Hambydammit

    A world renowned Scientist states:
    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in *****BIOLOGY*****. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    Your response:
    “If we’re talking about physics, then fine. DNA, being material, is information. But speaking chemically, DNA is just… chemicals.”
    – Hambydammit

    Who are we to believe, World renouned scientists or Hambydammit?

    As I continue to state over and over again, unless you can provide a peer reviewed publication that supports your contention that DNA is simply a metaphor or analogy ar a descriptor, then you will need to concede to the current accepted scientific convention:

    DNA is a Literal code!

    .

    Posted by PG | March 23, 2010, 8:01 pm
  17. BTW,

    You stated “The “code” is inherent in copper sulfate crystals.”

    Unless you can demonstrate that your copper sulfate crystals transmits information with a encoder to decoder communication system as rigourously defined by Shannon, then you have miserably failed to provide a naturally occuring code, and that you have also dont have an understanding of Communication systems, Bioinformatics, nor Yockeys scientific findings.

    .

    Posted by PG | March 23, 2010, 8:29 pm
  18. Now There is a court ruling that supports my position that DNA is a literal code!

    “The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body – namely, proteins, “biological molecules of enormous importance” which “catalyze biochemical reactions” and constitute the “major structural materials of the animal body.”

    and

    “Consequently, the use of simple analogies comparing DNA with chemical compounds previously the subject of patents cannot replace consideration of the distinctive characteristics of DNA.”

    31 March 2010
    Judge Rules DNA is Unique Because it Carries Functional Information
    Association for Molecular Pathology v. U.S. Patent and Trademark Office, __ F.Supp.2d __ (S.D.N.Y. 2010):

    http://www.uncommondescent.com/intelligent-design/judge-rules-dna-is-unique-because-it-carries-information/

    Posted by PG | April 1, 2010, 12:06 am
  19. You’re not saying anything new, PG. You haven’t addressed any of my points. I’m not going to keep saying the same things over and over.

    Posted by hambydammit | April 1, 2010, 5:53 pm
  20. As with my presented Peer review citations, If you read the Ruling carefully you would realize that the court ruling just refuted and disproved the foundation of your entire premise that DNA is simply chemical reactions! Your other points are secondary to your own topic article.

    You wrote:
    “If we’re talking about physics, then fine. DNA, being material, is information. But speaking chemically, DNA is just… chemicals.”

    The court ruled opinion:
    “The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body, Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body – namely, proteins, “biological molecules of enormous importance” which “catalyze biochemical reactions” and constitute the “major structural materials of the animal body.” O’Farrell, 854 F.2d at 895-96. ”

    and just as important,

    “Consequently, the use of simple analogies comparing DNA with chemical compounds previously the subject of patents cannot replace consideration of the distinctive characteristics of DNA.”

    Therefore,
    you must concede that DNA is not simply chemicals as you asserted and accept as irrefutable, “DNA is a literal code” unless you can yet produce any Peer reviewed literature that refutes my peer reviewed publications and court rulings:

    1) DNA is a literal code (By Scientific and Court rulings)
    2) All known codes are designed. (Repetable observation)
    3) DNA is proof of Design

    Consider: In this syllogism,
    1) True
    2) True
    3) True

    .

    Posted by PG | April 2, 2010, 10:31 am
  21. PG, you are arguing to hear yourself speak. Information theory does not offer any real insights to your argument because frankly you have to bend the evidence really far to even cast accepted answers into even a little bit of doubt.

    Information is immaterial when we assign a language to understood, unthinking, and natural arrangements of molecules. DNA itself may be incredibly complex, but it’s four components are not. There’s a reason we call it a code. We gave each nucleotide easy to recognize letterings and decided to plot out the entire thing. Does that mean it’s a code? No! It’s a predictable and self-replicating chemical process.

    I don’t think I should have to do this, but can you name a designed code that gives rise to even more complex code? DNA can improve because it makes errors (mutations) and the best ones are selected for. Designed codes do not have this ability. They do not make errors in replication because they in fact do not replicate. They cannot replicate because they are not material. If a code is material, it replicates because of it’s inherent qualities, not because of a design.

    How does this not make sense to you? Evidence supports this from every direction imaginable yet you still stand upside down telling us all we’ve got our perspectives backwards.

    At several instances you make argumentum ad populum which isn’t exactly strong. I mean yes, you cite some sources, but they’re poorly cited as those sources when fully understood actually work AGAINST you. To state that all of these clearly qualified individuals are somehow against the author is a fabrication at best. At worst is a dishonest lie, and an abuse of the words of the people speaking. In particular, the PHD Yockey you reference several times is specifically not creationist and very much argues against intelligent design. His works never claim that a code necessitates a designer. So how do you reach that conclusion using his source?

    The truth is, you don’t. Not logically. You are taking one source, and twisting it wildly to reach a conclusion you favor. I’m sure Yockey would not approve of this. What you’re doing amounts to cherry-picking the words of esteemed men and putting words in their mouths they never even spoke. How is that intellectually honest?

    This part bothers me though. You adhere strictly to information theory, which does not even apply to what we’re discussing (per your misunderstanding of course), but do not care even in the least about a proper definition of “code”, let alone the logical proof you missed completely. Even granting a designer you come light years from proving it’s a god, or even your god. It’s remarkably far off from accomplishing anything. And that’s AFTER granting you points already disproven!

    Can you see why we’re tired of people like you? This is the best stuff you have to offer. We scoff at this shit. It’s tiring.

    Posted by snoman | April 16, 2010, 4:31 am
  22. Snoman,

    You obviously simply jumped into this discussion without reading any of my posts. How do I know?

    I never ever mentioned a “GOD” in any of my posts. You are being truely intellectually dishonest as you defined it…

    In addition,
    I never stated that Yockey et. al. were “Creationists!” The discussion is about DNA being a literal code! (See Title of Discussion!) Yockey et al. have proven scientifically that DNA is a literal code! Therefore referenced! Again, another example of your intellectual dishonesty!

    However lets proceed,

    Snoman OPINION ….
    “Information is immaterial when we assign a language to understood, unthinking, and natural arrangements of molecules. DNA itself may be incredibly complex, but it’s four components are not. There’s a reason we call it a code. We gave each nucleotide easy to recognize letterings and decided to plot out the entire thing. Does that mean it’s a code? No! It’s a predictable and self-replicating chemical process.”

    Do you have any scientific journals that support your position that DNA is not a code Snoman?

    Science says….
    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in *****BIOLOGY*****. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    Science has created an entire field dedicated to bioinformatics which contradicts your entire premise…
    “Bioinformatics is the application of computer science to the field of molecular biology. The term bioinformatics was coined by Paulien Hogeweg in 1979 for the study of informatic processes in biotic systems. Its primary use since at least the late 1980s has been in genomics and genetics, particularly in those areas of genomics involving large-scale DNA sequencing. Bioinformatics now entails the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data…”
    http://en.wikipedia.org/wiki/Bioinformatics

    The Federal court ruled…
    “The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body – namely, proteins, “biological molecules of enormous importance” which “catalyze biochemical reactions” and constitute the “major structural materials of the animal body.”

    and

    “Consequently, the use of simple analogies comparing DNA with chemical compounds previously the subject of patents cannot replace consideration of the distinctive characteristics of DNA.”

    31 March 2010
    Judge Rules DNA is Unique Because it Carries Functional Information
    Association for Molecular Pathology v. U.S. Patent and Trademark Office, __ F.Supp.2d __ (S.D.N.Y. 2010):

    The syllogism:
    1) DNA is a literal code! (A scientific fact!)
    2) All known codes are designed. (Repeatable observation!)
    3)DNA is proof of design!

    I have provided the citations of scientists, an entire field of science, and the federal courts that refute your entire post and supports the scientific fact:

    DNA IS A LITERAL CODE!

    .

    Posted by PG | April 16, 2010, 12:39 pm
  23. Snoman says:
    I don’t think I should have to do this, but can you name a designed code that gives rise to even more complex code?

    PG says:
    No you shouldnt have done it because complexity is a demonstration of intelligent design.
    You see snoman, Cells employ a built-in algorithm, which engineers re-arrangement of Mobile Genetic Elements as observed by McClintock and Shapiro. McClintock recieved a Nobel Prize for her efforts. Too bad your biology teacher felt the need to protect you from any scientific findings that directs to intelligent design.

    Here is Shapiro’s research and conclusions regarding cells employing algorithems:
    http://shapiro.bsd.uchicago.edu/Shapiro.2005.Gene.pdf

    Now please provide empirical evidence of a naturally occuring Algorithm…

    After your done scoffing of course … or is that choking?

    .

    Posted by PG | April 17, 2010, 12:07 pm
  24. An arbitrary code, by definition, must be defined by an arbitrary equivalence table (ASCII table, English language, etc), and that table must be developed by an intelligent been, this is plain true.

    Since you believe DNA is an arbitrary code, it must be defined by an equivalence table, so, where is it defined within a cell?
    Where is that table that defines “codon X will bond to aminoacid Y”?

    There’s no such table, because the laws that govern codon-aminoacid bonding are the same that states if you put NaCl in H²O, the NaCl will dissociate into Na+ and Cl- ions. That’s chemistry, which laws are defined by physics, so here’s your table, it’s called physics.

    Now if you’re saying that DNA is an arbitrary code, and the equivalence table for that code is the laws of physics, you’re saying that the laws of physics are arbitrary, and it must be designed by an intelligent been, in other words, god.

    So, even if god designed the laws of physics arbitrarily, DNA reactions are governed by the very same laws of a combustion reaction, and hambydammit is plainly right saying that an explosion is no different from DNA, in the “code” point of view.

    Face it, god existing or not, life is no different from a crystal, or a tornado, just infinitely more complex, but still following the exact same rules, that are the physics laws.

    DNA is no proof of god better than gravity or oxidation, or anything else in the universe.

    If you want an example of a naturally ocurring code, as a proof of our point, i want an example of a naturally ocurring anything as a proof of yours, of course, you cannot pick nothing in the universe, since the laws of physics are arbitrary, and designed by something, it implies that nothing that exists is actually natural.

    Posted by Cochi | April 26, 2010, 11:13 am
  25. Hi Cochi,
    Not once have I ever stated anywhere that DNA is proof of a God. I am stating that DNA is proof of design. Please be so kind as to not further misrepresent my position.

    Again, It is not I, but Science that has proved that DNA is a literal code regardless of your attempt to insert new definitions and opinions. In deed, The definition of code I have provided is sufficient and applies whether the code is arbitrary or not. Again, Science defines “Coded Information” as a system of symbols used by an encoding and decoding mechanism, which transmits a message representing an idea or plan…

    Science says….
    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in *****BIOLOGY*****. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    In addition,
    The information in DNA is independent and seperate from the communication medium insofar as every strand of DNA in your body represents a complete plan for your body; even though the DNA strand itself is only a sequence of symbols made up of chemicals (A, G, C, T). For example, we could store a CAD drawing of a hard drive on the same model of hard drive, but the medium and the message are two distinctly different things. Such symbolic relationships only exist within the realm of living intelligence things; they do not occur unguided naturally.

    Therefore,
    Please provide empirical evidence that demonstrate that your crystals , gravity, or oxidation reactions transmits information with a encoder to decoder communication system as rigourously defined by Shannon,

    Or the syllogism remains:
    DNA is a literal code
    All known codes are designed
    DNA is proof of design

    PG

    .

    Posted by PG | April 27, 2010, 12:28 am
  26. Stop quoting and expose your thoughts, you’re saying that a GGG codon could perfectly have been designed to couple with something other than glycine? that’s ridiculous, you would have to change the entire laws of physics, since they ARE the reason why GGG translates to glycine, not some sort of special mechanism, but only chemical affinity, just like in droplets of water, or explosions, etc.

    Posted by Cochi | April 27, 2010, 1:49 am
  27. Cochi,

    You keep attempting to discard or deflect from the fact that DNA is a literal code according to scientific convention. I quote peer reviewed scientific publications and do not rely on personal opinions. I EXPECT you to support your positions with Peer reviewed scientific publications and not simply your opinions!

    Such as…

    Here is research done by Rutgers University that totally supports my position and clearly disproves your entire thought process!
    Read paragraph #3 and the research conclusions. DNA is a literal code and not simply a metaphor. Unless you can refute the Rutgers University research findings with a Peer reviewed Scientific publication
    The Linguistics of DNA

    Here are some more peer reviewed publications and articles that support my position and disproves your position…

    Again, Yockey is the considered the foremost bioinformatic scientist in the world:
    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    The genetic code is a set of 64 base triplets (nucleotide bases, read in blocks of three). A codon is a base triplet in mRNA. -Cell Biology and Genetics, Starr and Taggart, Wadsworth Publishing, 1995

    Genetic Code: The sequence of nucleotides, coded in triplets (codons) along the messenger RNA, that determines the sequence of amino acids in protein synthesis….
    -50 years of DNA, Clayton and Dennis, Nature Publishing, 2003

    “The problem of how a sequence of four things (nucleotides) can determine a sequence of twenty things (amino acids) is known as the ‘coding’ problem.” –Francis Crick

    “The unique mark of a living organism, shared with no other known entity, is its possession of a genetic program that specifies that organism’s chemical makeup. s….DNA carries genetic specificity. This structure immediately suggests that genetic specificity, the “information” that distinguishes one gene from another, resides in the sequence of nucleotides.”
    -The Way of the Cell, Franklin M. Harold, Oxford University Press, 2001

    “A code is a set of rules governing the order of symbols in communication. This defines a code, regardless of the nature of the symbols, be they alphabetic letters, voice sounds, dots and dashes, DNA bases, amino acids, nerve impulses, or what have you. Codes are generally expressed as binary relations or as geometric correspondences between a domain and a counterdomain; one speaks of mapping in the latter case. Thus, in the International Morse Code, 52 symbols consisting of sequences of dots and dashes map on 52 symbols of the alphabet, numbers and punctuation marks; or in the genetic code, 61 of the possible symbol triplets of the RNA domain map on a set of 20 symbols of the polypeptide counterdomain.
    -The Touchstone of Life: Molecular Information, Cell Communication and the Foundations of Life, by Werner R. Loewenstein, Oxford University Press, 1999

    “(George) Gamow devised a scheme, illustrated by means of playing cards, that involved sets of three adjacent nucleotides per amino acide unit (“triplet” code) in a sequence of overlapping triplets. That proposal spurred Francis Crick and his colleagues to examine the coding problem more critically and to use knowledge gained from genetic experiments to test the possible validity of Gamow’s scheme and its variants.
    -Proteins, Enzymes, Genes: The Interplay of Chemistry and Biology, Joseph S. Fruton, Yale University Press 1999

    “It had been revealed as the full complement of instructions embodied in a series of sets of three DNA nitrogenous bases. The totality of these long sequences were the instructions for the construction, maintenance, and functioning of every living cell. .”
    -The Human Genome Project: Cracking the Genetic Code of Life, by Thomas F. Lee, Plenum Press, 1991

    “The three-nucleotide, or triplet code, was widely adopted as a working hypothesis. Its existence, however, was not actually demonstrated until the code was finally broken…
    “With a knowledge of the genetic code, we can turn our attention to the question of how the information encoded in the DNA and transcribed into mRNA is subsequently translated into a specific sequence of amino acids in a polypeptide chain. The answer to this question is now understood in great detail… instructions for protein synthesis are encoded in sequences of nucleotides in the DNA molecule.”
    -Biology, 5th Edition, by Curtis & Barnes, Worth Publishers, 1989

    “The genetic code has many of the properties of codes in general, specifically the Morse Code, the Universal Product Bar Code, ASCII, and the US Postal Code. I shall explain the relation of these codes to the genetic code in the following discussion. Every code, as the term is used in this book, can be regarded as a channel with an input alphabet A and an output alphabet B.

    “Here is the formal definition of a code :
    Given a source with probability space [Omega, A, p(A)] and a receiver with probability space [Omega, B, p(B)], then a unique mapping of the letters of alphabet A onto letters of alphabet B is called a code.
    Here p(A) is the probability vector of the elements of alphabet A and p (B) is the probability vector of the elements of alphabet B. ( Perlwitz , Burks and Waterman, 1988)

    “Nature has extended the primary four-letter alphabet to the six-bit, 64 member alphabet of the genetic code. Each amino acid except Trytophan and Methionine has more than one codon . Thus, the genetic code is redundant (not degenerate). The sloppy terminology designating the genetic code as degenerate is responsible for most of the misunderstanding of the genetic information processing system.

    “The genetic code is distinct and uniquely decodable, because the single Methionine codon AUG, and sometimes the Leucine codons UUG and CUG, serve as a starting signal for the protein sequence and performs the same function as the long frame bars at the beginning of the postal message in the ZIP+4 code and the Universal Product Code. The codons UGA, UAA and UAG function usually as non-sense and stop the translation of the protein from the mRNA and initiate the release of the protein sequence from the mRNA ( Maeshiro and Kimura, 1998). They perform the same function as the long frame bar at the end of the postal bar code message (Bertram, 2001). Remember that non-sense does not mean nonsense or foolishness. Code letters are called non-sense because they have been given no sense or meaning assignment in the receiving alphabet.”
    (From Hubert Yockey , Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    Here is a specific definition of Genetic code from several of the online medical dictionarys:

    Medterms.com
    Definition of Genetic code
    Genetic code: The instructions in a gene that tell the cell how to make a specific protein. A, T, G, and C are the “letters” of the DNA code. They stand for the chemicals adenine, thymine, guanine, and cytosine, respectively, that make up the nucleotide bases of DNA. Each gene’s code combines the four chemicals in various ways to spell out 3-letter “words” that specify which amino acid is needed at every step in making a protein.
    The discovery of the genetic code clearly ranks as one of the premiere events in what has been called the Golden Age of Biology and Medicine.
    http://www.medterms.com/script/main/…rticlekey=3574

    Biology-Online.org
    Answers to all your Biology Questions
    Definition of Genetic code:
    (Science: molecular biology) relationship between the sequence of bases in nucleic acid and the order of amino acids in the polypeptide synthesised from it. A sequence of three nucleic acid bases (a triplet) acts as a codeword (codon) for one amino acid.
    http://www.biology-online.org/dictionary/Genetic_code

    Definition of Genetic code:
    “The information carried by DNA” that determines the specific amino acids and their sequence in each protein synthesized by an organism…..
    http://medical-dictionary.thefreedic…l+Genetic+Code

    Here is even a court ruling…

    “The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body – namely, proteins, “biological molecules of enormous importance” which “catalyze biochemical reactions” and constitute the “major structural materials of the animal body.”

    and

    “Consequently, the use of simple analogies comparing DNA with chemical compounds previously the subject of patents cannot replace consideration of the distinctive characteristics of DNA.”

    31 March 2010
    Judge Rules DNA is Unique Because it Carries Functional Information
    Association for Molecular Pathology v. U.S. Patent and Trademark Office, __ F.Supp.2d __ (S.D.N.Y. 2010):

    So you see Cochi,

    You need to provide peer reviewed publications which support your position that DNA is not a code or move on to try and find a naturally occuring code to disprove the syllogism:

    DNA is a literal code
    All known codes are designed
    DNA is proof of design

    PG

    Posted by PG | April 27, 2010, 3:46 am
  28. Forget it. you just don’t want to understand my point, you didn’t even read it, just keep repeating yourself.

    Posted by Cochi | April 27, 2010, 2:11 pm
  29. My point is simple;

    I understand what you are attempting to illustrate regarding YOUR understanding of DNA as a metaphorical code, however its pointless for you to debate it because the current scientific convention is that DNA is a literal code! If you dont like it take it up with science.

    In the mean time

    DNA is a literal code!
    All known codes are designed
    DNA is proof of design!

    .

    Posted by PG | April 27, 2010, 2:20 pm
  30. I just wrote a post about people like you, PG. It’s honestly pretty scary that such a simple concept is still being debated. It’s sad when armchair philosophers genuinely believe they get to tell hundreds of thousands of scientists that they’re wrong. Talk about arrogant!

    Anyway, check this out. It’s about you.

    Posted by hambydammit | April 27, 2010, 2:36 pm
  31. Hamby,

    You keep posting on your other articles that DNA is not a literal code, you have offered zilch, nada, zero peer reviewed articles to back up any of your statement to back up your “DNA is not a code” article or that science does not consider DNA to be a literal code, while at the same time you continue to ignore the mountain of peer reviewed articles that specifically state:

    DNA IS A LITERAL CODE!.

    Its typical though, once Atheists begin to understand the implications that scientists have empirically evidenced that DNA is a literal code, all Atheists can do is fault the very evolutionary scientists making the claims or ignore the damning findings entirely….

    Is that why you chose not to post this article with your other ones you wrote?

    ; )

    .

    Posted by PG | April 28, 2010, 2:54 am
  32. OK, DNA may be a code, and maybe, intelligent beings are the only ones who can create codes.

    That still does not prove there is a supreme deity. Any being, albeit otherworldly, could have created this code.

    The DNA code argument does not prove there is a god!

    Posted by Digilog | November 9, 2010, 3:48 pm
  33. Thanks, Digilog. That’s a great point. It can extend to a lot of claims, too. Someone got miraculously healed? Great, but it doesn’t prove a deity, and even if it did, it wouldn’t necessarily prove Jesus. There’s a LONG way to go from demonstrating intelligent design and… well… anything else.

    Posted by hambydammit | November 9, 2010, 4:46 pm
  34. Digilog, on November 9, 2010 at 3:48 pm said:
    OK, DNA may be a code, and maybe, intelligent beings are the only ones who can create codes.
    That still does not prove there is a supreme deity. Any being, albeit otherworldly, could have created this code.
    The DNA code argument does not prove there is a god!

    PG says:

    Correct, it would just prove that you were created by an intelligent designer…

    Posted by PG | December 22, 2010, 11:28 pm
  35. Ok PG, can you again tell us what is this “peer reviewed” paper telling “DNA must have been designed by an intelligence”, explicitly? or is that statement just an opinion of yours BASED on these papers?

    There have been papers about all sort of crazy stuff out there, you shoud really filter your sciece readings.

    Anyway, saying that intelligent design is the most accepted scientific explanation for DNA is just ridiculous dude, it`s simply not, ask any biologist out there.

    Posted by Cochi | December 26, 2010, 12:03 pm
  36. Cochi, one thing you may not know about PG… he thinks that if anyone reviews a paper, it’s peer reviewed. So he sometimes reads stuff by ID people that has been reviewed by ID people and believes it.

    Posted by hambydammit | December 26, 2010, 4:54 pm
  37. Cochi,

    Read the subject matter of this Blog. Hamby wrote a Post stating that DNA is not a code. I have only presented mainstream science reviewed papers (READ ABOVE ENTRIES) from respected evolutionary scientists and universities that support my position that DNA is a literal code while completely exposing Hamby as full of shit. Now he is trying to discredit by posting lies about my papers being from IDers rather than simply retracting his fucked up post…

    BTW, Not once have I ever stated that these papers were written to prove a deity or to state that ID is the most acepted scientific explaination as you state.

    The fact is that science accepts DNA as a literal code. They now need to show how information can arise from nonintelligence. I wish them luck..

    Posted by PG | December 31, 2010, 9:21 pm
  38. Hamby,
    For the hundreth time, provide one peer reviewed paper to support your position that DNA is not a code, or shut the f*** up once and for all…

    Posted by PG | December 31, 2010, 9:22 pm
  39. Hamby,

    Please accept my humble apology about the above post.. Someone dear to me passed away earlier in the day I wrote the posts and I thought surfing the net would get my mind off things.

    It didnt.

    For what its worth, I enjoy coming to this site. Even though we clash on ideals you have been a most gracious host as well as the other posters, as compared to some of the militant atheists boards out there. My new stance is to appreciate more the hospitality and learning experiance.

    I wish you and yours and everyone a Happy New Year…

    Posted by PG | January 2, 2011, 1:27 pm
  40. PG, let me propose a mind experiment:

    take the English language (code), and, let`s say, swap all “a” and “g”:

    “Now tgkina gccount for thgt rule, you cgn still write megninafull english, right?”

    now think of numbers, they`re characters that represents something as well, quantites, so let`s try to swap all “6” and “9” in a decimal base:

    19 = 4 x 4 = true;
    96 = 56 + 10 = true;

    numbers still work if you swap algarisms meanings, now try to swap every “a” and “g” in an actual DNA molecule:

    now if you sequence that molecule, it can have exactly the same meaning for you, but if you inoculate that molecule into a cell nucleus, it will never work, and the cell will die, because it`s not gonna synthesize any meaningful protein. now PG, can you see the difference? there is nothing being interpreted in DNA as in english or quantites, DNA “letters” CANNOT mean something else, as in all designed codes.

    Posted by Cochi | January 2, 2011, 4:15 pm
  41. Cochi, that’s a great way to explain it. I’m adding that as the first round in my arsenal from now on. Very concise and simple. Thank you!

    Posted by hambydammit | January 3, 2011, 3:41 am
  42. Cochi says:

    “Now tgkina gccount for thgt rule, you cgn still write megninafull english, right?”

    PG says:
    Since you emphasize human linguistics, I will as well.

    Today with the exception of a few atheist motivated scientists, It is widely accepted that DNA is a literal code. A long time ago DNA “Code” was perhaps considered a metaphor until more discoveries proved that DNA was not only a literal code but also found to be isomorphic to human languages. There is an entire field of Bioinformatics that is based on this very premise that DNA is a literal code and not simply a metaphor. Try convincing an entire field of science and those scientists that they are simply experiancing delusions and simply imagining that DNA is a literal code like shapes in a cloud. The fact is that those scientists are not dilusional.

    Google: DNA Linguistics, etc, for the numerous scientific papers that support my position.

    For example:

    The Linguistics of DNA: Words, Sentences, Grammar, Phonetics, and semantics

    http://www.rci.rutgers.edu/~sji/Linguistics%20of%20DNA.pdf

    Simply read the first 2 pages paying close attention to the third paragraph, the comparison tables,and conclusions, then report back to us.

    PG.

    Posted by PG | January 4, 2011, 4:01 am
  43. That simply underscores the point several people have explained multiple times. DNA being a code does not imply a creator of said code. That would be the watchmaker argument. If it did, we’d be teaching ID in schools as the basis for evolution, there being a whole field of science dedicated to DNA = code.

    Again, this is simply you being dense.

    Posted by Alex Hardman | January 4, 2011, 7:54 am
  44. PG says:

    Pssssst Alex,
    Let me tell you a litlle secret…
    DNA=Code has created an entire new field of of science called Bioinformatics and is in fact currently being taught in most major universities…..

    You are incorrect regarding the watchmaker arguement. I have never leaned on the ID premise that the DNA is specified complexity but rather that the information in DNA is seperate from the medium just like the software program on your computer is seperate from the hardware. In all known encoder to decoder processes transmitting semantical messages such as “language” , the code or language is always seperate from the medium.

    In addition, CURRENTLY, all known encoder to decoder processes transmitting semantical information… require a mind.

    Science is desperately trying to find a natural evolutionary process that could perhaps produce a encoder to decoder process that transmitts semantical messages. Most eminent scientists such as Yockey and Crick have personally stated the vast challenges ahead for scientists because the answer is to find a new yet undiscovered natural law that could account for the evolution of information in DNA.

    Their are however dense posters with atheist agenda’s who completely disregard scientific convention that DNA is a literal code and simply pretend its really just a metaphor. thats not science, thats religion.

    Posted by PG | January 4, 2011, 2:19 pm
  45. DNA=Code has created an entire new field of of science called Bioinformatics and is in fact currently being taught in most major universities…..

    Thank you, PG. I was waiting for something to top the “Dumbest thing PG has ever said” list. Bioinformatics is the science of converting the information stored in DNA into meaningful code that can be manipulated and used by humans. The problem is THAT IT IS NOT ENCODED, and we must encode it to make use of it.

    Posted by hambydammit | January 4, 2011, 2:27 pm
  46. The watchmaker argument is not simply that the watch is so complex that it must have a designer, but also the fact that there is a designer to begin with. You are implying that because all known codes (i.e. watches) are designed (ergo by a designer), and DNA = code, that DNA must have been designed (again, but a designer).

    Same argument, equally stupid.

    Posted by Alex Hardman | January 4, 2011, 3:51 pm
  47. Hamby and Alex,

    Rather than me responding to your retarded and worthless posts, Why dont you both read the Rutgers university findings that DNA is not only a literal code, but is actually isomorphic to the human languages. It basically affirms that you both are full of shit regarding DNA code just being a metaphor.

    Or better yet, provide just one peer reviewed paper that supports your position of DNA being just a metaphor so you dont look so stupid trying to play scientists without any factual scientific evidence…

    Until then, the syllogism stands:

    1) DNA is a literal code

    2) 100% of all known codes come from a mind,
    0% of known codes come from non-living things.

    3) ttherefore, DNA is from a mind.

    Join science to find that just one naturally occuring coding process to prove me wrong or STFU!!!

    .

    Posted by PG | January 4, 2011, 7:57 pm
  48. Alex says:
    “You are implying that because all known codes (i.e. watches) are designed…, and DNA = code, that DNA must have been designed.
    Same argument, equally stupid”

    PG says:
    Lets play a mind game. Lets switch a couple of words…

    “You are implying that because all known men are mortal, and Socrates is mortal, that Socrates must have been mortal.
    Same argument, equally stupid”

    Lets just face the truth Alex. The atheist position cannot accept one of the most fundamental definitions in modern science, once the implications become clear: If DNA is a code, then we have every reason to believe that it is designed.

    .

    Posted by PG | January 5, 2011, 12:52 am
  49. You failed in your switching:

    “You are implying that because all known men are mortal, and Socrates is mortal, that Socrates must have been mortal.

    Now, I’m assuming you meant to switch mortal with designed, Socrates with DNA, and men with code[s]. There are two interpretations (due to your “typos”)
    What it could have said was:
    You are implying that because all known men [codes] are mortal [designed], and Socrates [DNA] is mortal [designed], that Socrates must have been a man.

    You could also have meant:
    You are implying that because all known men [codes] are mortal [designed], and Socrates [DNA] is man , that Socrates [DNA] must have been mortal [designed].

    You fail at your first premise, which requires proof.

    In the case of men, we have no evidence to support the contradicting claim (that not all men are mortal, unless you’re a bible thumper, but you constantly assert that is not the point of the debate…), but in the case of codes we do. Most spoken languages are evolved things, not designed. You would do well to accept this fact.

    Some things can be equated, some things cannot. Stop trying to confuse the issue with things that cannot.

    Posted by Alex Hardman | January 5, 2011, 10:14 am
  50. Oh, and I apologize for being so retarded I can’t understand why you keep changing the terms of the debate.

    “Designed” and “come from a mind” are not the same thing.

    Also your definition (or rather acceptance of what constitutes a) code seems to vary with the moment. Otherwise, why are tree rings not a code, or rock wear patterns beneath water falls, or rain fall patterns, or river bed erosion patterns. All of these things (given enough math) convey information about the processes they involve. Would you claim they were designed as well?

    I must certainly be retarded, as I can’t understand what this has to do with atheism, since you keep insisting it’s not about your belief in a “god”, but instead about the science…

    Posted by Alex Hardman | January 5, 2011, 10:24 am
  51. PG, in what universe the information contained in the DNA is separate from it`s medium?

    In what universe DNA makes sense without a chemical environment where it can express itself by organizing particles around it?

    DNA is just a chemical catalyzer, a real complex one but it simply cannot make sense without gravity, atoms, sunlight, and everything else you see around you, if our environment was a different one, every form of life here would be different too, cause DNA is not some magical set of instructions that collects atoms from everywhere just in the right proportions and always make a pretty boy, the same boy in the desert and in the tropics, DNA is a catalyzer that facilitates chemical reactions, given the right concentrations of chemicals, and simply cannot work in most conditions, so it`s information is completely dependent on it`s medium.

    Indeed it`s information EVOLVED from it`s medium, that is what real scientists call evolution, or, selective pressure over a specific gene that causes good mutations to survive.

    All designed codes are abstract, DNA is not abstract as it`s meaning cannot be changed by convention.

    And finally, if you really believe something other than chemistry and physics is happening within the living cell, why don`t you demonstrate that, why don`t you measure that force and tell us where it comes from?

    When you don`t understand something, it doesn`t mean someone smarter than you did it, it just means you don`t have enough knowledge to understand it, humans once believed rain was sent by the gods, the fact that we couldn`t understand condensation by the time don`t make those gods real, it just makes us look back and think how dumb we were believing in such absurdity.

    Posted by Cochi | January 5, 2011, 12:35 pm
  52. Well since several posters on this board continue to avoid peer reviewed papaers findings on the linguistis of DNA, perhaps the U.S courts can weigh in on this issue and educate the atheists on this board.
    Obviously, the matter of DNA being simply chemical reactions and not an literal code was argued extensively and beyond the limiting capacity of a blog so lets analyze the U.S court ruling.

    31 March 2010
    Judge Rules DNA is Unique Because it Carries Functional Information

    Here is the actual text of Judge Sweet’s opinion:

    Association for Molecular Pathology v. U.S. Patent and Trademark Office, __ F.Supp.2d __ (S.D.N.Y. 2010):

    The question thus presented by Plaintiffs’ challenge to the composition claims is whether the isolated DNA claimed by Myriad possesses “markedly different characteristics” from a product of nature. In support of its position, Myriad cites several differences between the isolated DNA claimed in the patents and the native DNA found within human cells. None, however, establish the subject matter patentability of isolated BRCA1/2 DNA.

    The central premise of Myriad’s argument that the claimed DNA is “markedly different” from DNA found in nature is the assertion that “[i]solated DNA molecules should be treated no differently than other chemical compounds for patent eligibility,” Myriad Br. at 26, and that the alleged “difference in the structural and functional properties of isolated DNA” render the claimed DNA patentable subject matter, Myriad Br. at 31.
    Myriad’s focus on the chemical nature of DNA, however, fails to acknowledge the unique characteristics of DNA that differentiate it from other chemical compounds. As Myriad’s expert Dr. Joseph Straus observed: “Genes are of double nature: On the one hand, they are chemical substances or molecules. On the other hand, they are physical carriers of information, i.e., where the actual biological function of this information is coding for proteins. Thus, inherently genes are multifunctional.” Straus Decl. 1 20; see also The Cell at 98, 104

    *****(“Today the idea that DNA carries genetic information in its long chain of nucleotides is so fundamental to biological thought that it is sometimes difficult to realize the enormous intellectual gap that it filled. . . . DNA is relatively inert chemically.”)*****

    ; Kevin Davies & Michael White, Breakthrough: The Race to Find the Breast Cancer Gene 166 (1996) (noting that Myriad Genetics’ April 1994 press release described itself as a “genetic information business”).

    ***This informational quality is unique among the chemical compounds found in our bodies, and it would be erroneous to view DNA as “no different[]” than other chemicals previously the subject of patents***.

    (READ THE FOLLOWING CAREFULLY ATHEISTS)

    Myriad’s argument that all chemical compounds, such as the adrenaline at issue in Parke-Davis, necessarily conveys some information ignores the biological realities of DNA in comparison to other chemical compounds in the body.

    *******The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body********
    – namely, proteins, “biological molecules of enormous importance” which “catalyze biochemical reactions” and constitute the “major structural materials of the animal body.” O’Farrell, 854 F.2d at 895-96. DNA, and in particular the ordering of its nucleotides, therefore serves as the physical embodiment of laws of nature – those that define the construction of the human body. Any “information” that may be embodied by adrenaline and similar molecules serves no comparable function, and none of the declarations submitted by Myriad support such a conclusion.

    (LETS DRIVE THE POINT HOME AGAIN)
    Consequently, the use of simple analogies comparing DNA with chemical compounds previously the subject of patents cannot replace consideration of the distinctive characteristics of DNA.

    In light of DNA’s unique qualities as a physical embodiment of information, none of the structural and functional differences cited by Myriad between native BRCA1/2 DNA and the isolated BRCA1/2 DNA claimed in the patents-in-suit render the claimed DNA “markedly different.” This conclusion is driven by the overriding importance of DNA’s nucleotide sequence to both its natural biological function as well as the utility associated with DNA in its isolated form. The preservation of this defining characteristic of DNA in its native and isolated forms mandates the conclusion that the challenged composition claims are directed to unpatentable products of nature.

    Id., at __ F.Supp.2d __, slip op. pgs. 121 – 125, internal citations omitted

    Posted by PG | January 5, 2011, 2:44 pm
  53. “***The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body*** ”

    “***This informational quality is unique among the chemical compounds found in our bodies, and it would be erroneous to view DNA as “no different[]” than other chemicals previously the subject of patents*** ”

    DNA is not just chemical reactions, but carries real, objective, semantical coded information.

    CASE CLOSED!!!!

    Posted by PG | January 5, 2011, 2:51 pm
  54. CASE CLOSED!!!!

    When was it open? You’ve been wrong the entire time.

    Posted by Alex Hardman | January 5, 2011, 7:23 pm
  55. Alex Hardman, on January 5, 2011 at 10:24 am said:
    Also your definition (or rather acceptance of what constitutes a) code seems to vary with the moment. Otherwise, why are tree rings not a code, or rock wear patterns beneath water falls, or rain fall patterns, or river bed erosion patterns. All of these things (given enough math) convey information about the processes they involve. Would you claim they were designed as well?

    PG says:

    I think you have forgotten my original definition of coded information, from the very beginning of this thread: I define “Coded information” as a system of symbols used by an encoding and decoding mechanism, which transmits a message representing an idea or plan that is independent of the communication medium.

    Infact let me repost:

    Here is the formal definition of a code by Perlwitz :
    Given a source with probability space [Omega, A, p(A)] and a receiver with probability space [Omega, B, p(B)], then a unique mapping of the letters of alphabet A onto letters of alphabet B is called a code.
    ( Perlwitz , Burks and Waterman, 1988)

    Alex,
    In Simple terms,

    Encoder >>> Message of idea or plan >>> Decoder

    None of your examples are a communication system as defined by Yockey or Perlwitz.

    Posted by PG | January 6, 2011, 2:27 am
  56. Alex,
    Perhaps you should refrain from the silly commentaries until you have a rudamentary understanding of what constitutes coded information as defined in information theory.

    Posted by PG | January 6, 2011, 2:29 am
  57. Tree rings: tree (encoder) -> env. data (info) -> person looking at tree rings (decoder).

    How is this any less a code than DNA?

    Perhaps I should stop arguing with people have actual position, other than to contradict whatever the evil atheists say.

    Posted by Alex Hardman | January 6, 2011, 8:53 am
  58. Perhaps I should stop arguing with people have actual position, other than to contradict whatever the evil atheists say.

    Should have been:
    Perhaps I should stop arguing with people who have no actual position, other than to contradict whatever the evil atheists say.

    The flippancy is totally lost when making typos from my mobile. Curse you FSM for your hidden noodly interference.

    Posted by Alex Hardman | January 6, 2011, 9:31 am
  59. PG, coded communication systems, designed ones, have something DNA can never have, a mapping, a table that says x means now y, this is why DNA is not a designed code but a beautiful example of natural ocurring code, because it`s mapping is the very same laws that govern all the universe, living and nonliving.

    And i agree whit that judge, you are the one misinterpreting him, DNA represents for us living beings the most important thing, because it`s what makes us alive, but this has nothing to do with design or divinity, it`s a matter of value, DNA is the most valuable thing to life, therefore we should protect it from evil patents by corporations, but it doesn`t prove a designer to it.

    Posted by Cochi | January 6, 2011, 11:16 am
  60. Cochi, on January 6, 2011 at 11:16 am said:
    “PG, coded communication systems, designed ones, have something DNA can never have, a mapping, a table that says x means now y, this is why DNA is not a designed code but a beautiful example of natural ocurring code, because it`s mapping is the very same laws that govern all the universe, living and nonliving”

    PG says:
    Science refutes your statement:
    “A code is a set of rules governing the order of symbols in communication. This defines a code, regardless of the nature of the symbols, be they alphabetic letters, voice sounds, dots and dashes, DNA bases, amino acids, nerve impulses, or what have you. Codes are generally expressed as binary relations or as geometric correspondences between a domain and a counterdomain;
    ***one speaks of mapping in the latter case***
    Thus, in the International Morse Code, 52 symbols consisting of sequences of dots and dashes map on 52 symbols of the alphabet, numbers and punctuation marks;
    ***or in the genetic code, 61 of the possible symbol triplets of the RNA domain map on a set of 20 symbols of the polypeptide counterdomain***.
    -The Touchstone of Life: Molecular Information, Cell Communication and the Foundations of Life, by Werner R. Loewenstein, Oxford University Press, 1999

    Posted by PG | January 6, 2011, 12:16 pm
  61. ok, so how do you think those triplets map to the polypeptides?

    In morse the map is a table, an equivalence table that is human convention, that means any or even all of the 52 dot-dash symbols could be mapped to any other letter, or even other alphabets, and we could still call it morse, and any equipment following that same table would work the vey same way.

    In DNA, triplets map to polypeptides not by convention, not by some sort of conversion table, but it emerges from chemical affinity, in other words, chemical compound triplet x reacts chemically with polypeptide y, and if it could be different, maybe you coud set a glass of water on fire too, cause changing this kind of rules, changes everything else in the universe.

    So, in short, if you`re saying DNA mappings are designed, you`re saying that all matter, energy, space and time in the universe are designed to make DNA possible, and everything else is collateral.

    Posted by Cochi | January 6, 2011, 12:41 pm
  62. Cochi,

    You stated that DNA is a “beautiful example of natural ocurring code”

    I have already provided empirical evidence that DNA is not simply a code but is actually isomorphic to the human language and codes. Infact it met your own definition of a human designed code. Re-read the Rutgers university paper.

    The real issue is the implications of the discovery of a highly sophisticated communication system in DNA that is more complex than any human designed code. Posters on this board are going to great lengths to claim it is simply chemical reactions. The courts disagree, its more than just chemical reactions.
    However, you and others have no empirical evidence that DNA is a naturally occurring code. You and others on the board dont get to automatically apply your priori naturalist philosophical assumptions.
    While eminent scientists are trying desperately to find a natural law and evolutionary processes that accounts for the information in DNA, you have already convinced yourself without the evidence. Thats not science, thats religion…

    Posted by PG | January 6, 2011, 12:52 pm
  63. And now we get to the meat of the matter. Belief in a natural basis for ANYTHING is not an a priori claim. It is the default position until you can provide am example (and corresponding proof) of any other position. Your belief in creationism is not proof. Just because something seems designed is not proof it is. This is the simple fact you keep dodging.

    Posted by Alex Hardman | January 6, 2011, 6:05 pm
  64. Alex,
    Your arrogant philosophical dogma is dead. Your weak atheism claim of default position is based on the works in the Presumption of Atheism (1976) as written by the worlds most notorious atheist -Antony Flew.

    Later in (2004) Antony Flew rejected the idea of the presumption of atheism and shortly thereafter publically stated his rejection of atheism altogether and became a Deist based on the very issues we are now discussing – The origin of coded information in DNA.

    Now, If the worlds foremost Atheist philosopher who penned the presumption of atheism, moves from the atheist default position after observing the discoveries made on DNA for over 16 years, and follows the evidence to an eventual belief in an intelligent designer,

    Then who has more credibility, you or Antony Flew?

    Still it doesent matter because it is irrelevent. Since science has not provided any empirical evidence of a natural origin of DNA, your attempts to impose a burden of proof is is simply laughable and completely unconstructive to any scientific discussion….as usual. It does however explain why you offer no references to any scientific publications because you dont follow the evidence, you follow the dogma…

    Posted by PG | January 7, 2011, 3:46 am
  65. Cochi, on January 6, 2011 at 12:41 pm said:
    So, in short, if you`re saying DNA mappings are designed, you`re saying that all matter, energy, space and time in the universe are designed to make DNA possible, and everything else is collateral.

    PG says:
    I have previously addressed this question.

    “Information is information, neither matter nor energy. Any materialism that fails to take account of this will not survive one day.” -Norbert Weiner, The father of cybernetics,

    That is a very profound statement Cochi. Is it true?You dont have to think about it very long to realize it’s absolutely true.

    Matter, Energy and Information are three Distinct Entities. Information cannot be created without intent. There are no examples of information that is created without intent. You have to have the dimension of intent or will, which is a property of a conscience mind, in order to have any kind information. Otherwise all you have is chaos. All you have is tornadoes and hurricanes and stalactites and stalagmites and snowflakes. But you do not have any kind of language whatsoever.

    The question then is where and when did this information originate?

    Posted by PG | January 7, 2011, 4:32 am
  66. Just amagine Cochi,
    We havent even began discussions on the fact that science has discovered that DNA is an elegant code that is self-repairing, self-correcting, self-re-writing and self-evolving and reveals a level of engineering and sophistication that human engineers could only dream of.

    Intent or random?

    Posted by PG | January 7, 2011, 4:34 am
  67. Still it doesent matter because it is irrelevent. Since science has not provided any empirical evidence of a natural origin of DNA, your attempts to impose a burden of proof is is simply laughable and completely unconstructive to any scientific discussion….as usual. It does however explain why you offer no references to any scientific publications because you dont follow the evidence, you follow the dogma…

    This is the problem. The burden of proof is always on the person asserting something. No one here is asserting any origin to DNA but you. You are asserting that DNA was designed. That must be proven, not implied.

    Oh, and I’m not an atheist.

    Posted by Alex Hardman | January 7, 2011, 8:01 am
  68. PG, i never said information was matter, or energy, i KNOW information is different from matter and energy, but one thing you`re missing is that nothing other than matter and energy exists in the universe, so, information is not a third “thing” in the real sense of the word, information is abstract and doesn`t physically exist, information emerges naturally everywhere, because we can extract it from whatever natural stuff we look at. information really is the arrangement of matter/energy we give meaning to it, nothing else, information in the DNA exists only inside our minds, to facilitate the understanding of the sequence.

    DNA is NOT a language, it`s isomorphic to a language but it`s not one. any language has meaning independent of it`s nature, i can say the same phrase in 5 languages, DNA cannot be translated to english or C++, i cannot make the same protein from 5 different sequences of DNA, there are no living beings that run any other “language” instead of DNA
    and if it was, they would not be made of the same proteins we are made of.

    i love you, mi amas vin, eu te amo, ich liebe dich. – all mean the same.

    actgtgcactgtcagctagctaggtcgatcga – nothing else could mean the same as this

    come o PG, what`s the problem with you? can`t you believe random mutation can lead to evolution?
    do you reeeeeeally think random mutations should only produce chaos?

    I know if i don`t cite any scientists you will just keep repeating yourself, so i will ask you to read a book called “A New Kind of Science” by Stephen Wolfram, worlds most prominent mathematician, this book should explain you the process of complexity emerging from simplicity, and any scientific literature about genetic algorithms, that demostrate beautifuly how selection, random mutation, and breeding leads to solution softwares that were never really designed but rather evolved automatically, or assistedly by human input of fitness numbers, but never by messing directly with the genes, wich is a highly destructive approach to evolution.

    Posted by Cochi | January 7, 2011, 9:02 am
  69. Cochi, sorry to break the news to you, but PG isn’t going to be reading anything. He’s what we call a troll. Some of us, stupidly it must be admitted, continue to feed him, but we understand he’s not actually listening.

    He believes his “god” did it, and we horrible atheists simply refuse to see his “logic”. This is the real debate he’s having, not related to DNA, except abstractly.

    Posted by Alex Hardman | January 7, 2011, 10:41 am
  70. thanks for the advice Alex, PG is not really into listening.
    anyway, these posts inspired me doing an experiment with genetic algorithms that will show these people demonstratively how things work.

    Posted by Cochi | January 7, 2011, 12:47 pm
  71. People have been demonstrating how things work to IDiots for years, nay decades. It hasn’t worked yet.

    What we need is to force better science education in primary school. Cut them off before they can be corrupted into such stupidity in the first place. Then at least they’ll be using real science to argue, instead of “My ‘god’ did it, and you can’t prove otherwise”.

    Posted by Alex Hardman | January 7, 2011, 1:07 pm
  72. Yeah, it creeps me out thinking these kind of absurd will be taught to my kids in the future, then everything we studied and learned and experimented and discovered will be denied by the teachers, and my kids will need to hear from me their teachers are liers, sad.

    Hope my future offspring will choose hearing me.

    Posted by Cochi | January 7, 2011, 1:41 pm
  73. Cochi, on January 7, 2011 at 9:02 am said:
    ‘PG, i never said information was matter, or energy, i KNOW information is different from matter and energy, but one thing you are missing is that nothing other than matter and energy exists in the universe,”

    So, information is not a third “thing” in the real sense of the word, information is abstract and doesn`t physically exist, information emerges naturally everywhere, because we can extract it from whatever natural stuff we look at. information really is the arrangement of matter/energy we give meaning to it, nothing else, information in the DNA exists only inside our minds, to facilitate the understanding of the sequence.

    PG says:

    Cochi:
    Your science is flawed. Here is THE eminent evolutionary biologist that refutes your entire premise:

    “Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter… These two domains will never be brought together in any kind of the sense usually implied by the term “reductionism.” …The gene is a package of information, not an object… In biology, when you’re talking about things like genes and genotypes and gene pools, you’re talking about information, not physical objective reality… This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms.”
    -George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995, pp. 42-43

    Posted by PG | January 9, 2011, 1:44 am
  74. Cochi, on January 7, 2011 at 9:02 am said:
    Information is not a third “thing” in the real sense of the word, information is abstract and does not physically exist, information emerges naturally everywhere…

    PG says:
    Again, I question if your logic is based in science or religion.

    An eminent scientist disagrees:
    “Information is information, neither energy nor matter. Any materialism that fails to take account of this will not survive one day.”
    –Norbert Weiner, MIT Mathematician and Founder of Cybernetics

    If I may add commentary:

    You insist information is abstract and does not physically exist until human’s can observe and give meaning to the observation.

    This is incorrect.

    First lets define what is “Real.
    Dictionary definition of “real”: 1. Being or occurring in fact or actuality; having verifiable existence: real objects; a real illness. 6. Philosophy. Existing objectively in the world regardless of subjectivity or conventions of thought or language.

    So Cochi, Information is real. It can create cause and effect and affect real events. What you are now reading is real regardless of if you disagree or agree with the message or dont read the message at all. DNA causes a baby to grow regardless of if you are observing it and giving it meaning.

    If you bothered to read Yochey, you would know that he states that the sequence of base pairs DNA has explicit meaning in the form of proteins they code for. Meaning is assigned within the encoding / decoding system. Not by you! It exists whether you as a human is there to understand it or not.

    Let me repeat that gain and again…
    Meaning is assigned within the encoding / decoding system. Not by you! It exists whether a human is there to understand it or not.

    Posted by PG | January 9, 2011, 1:52 am
  75. Cochi, on January 7, 2011 at 9:02 am said:
    Come on PG, what`s the problem with you? can`t you believe random mutation can lead to evolution?
    do you reeeeeeally think random mutations should only produce chaos?

    The Research papers I have submitted to this blog overwhelmingly indicates that the source of evolution is systematic mechanisms like transposition, symbiogenesis, genome doubling, epigenetics and horizontal gene transfer. Not copying errors. If you wish to believe that 3 billion letters of DNA forming precise instructions to build self-replicating nano-machines could arise by chance, then that is your decision. I believe in God with a capital G. You believe in Chance with a capital C.

    Posted by PG | January 9, 2011, 1:54 am
  76. And finally,

    Cochi, on January 7, 2011 at 9:02 am said:
    “I know if i don`t cite any scientists you will just keep repeating yourself, so i will ask you to read a book called “A New Kind of Science” by Stephen Wolfram, worlds most prominent mathematician”,

    PG say:
    Interesting. After almost a year, I finally get a scientific reference to a scientist who apparently gave a TED talk and stated that the Universe is at its base computational.

    If the universe is computational, then who’s the programmer? On his TED talk Stephen invokes multiverse’s as if he found a million of them. IDer’s do know better to mix speculation with science. Regardless he never indicated if a programmer is on one of those yet undetected universes.

    Why consider a programmer?

    “A coding system always entails a nonmaterial intellectual process. A physical matter cannot produce an information code. All experiences show that every piece of creative information represents some mental effort and can be traced to a personal idea-giver who exercised his own free will, and who and who is endowed with an intelligent mind….

    ***There is no known law of nature, no known process and no known sequence of events which can cause information to originate by itself in matter…’***
    -” Dr. Werner Gitt, A director and professor at the German Federal Institute of Physics and Technology

    Why Atheists forget that little factoid is beyond comprehension.

    Posted by PG | January 9, 2011, 2:02 am
  77. First of all, i`m not an atheist, i`m an agnosticist.

    Science cannot state “God” doesn`t exist, simply because it`s unprovable, just like it`s existence.

    It makes sense to me if you say a creator made space, time, and all the quantum rules, that we don`t understand fully yet, but is what makes our universe work, it`s a reasonable level of faith, and i agree with Wolfram in that sense, there is a big chance our universe is a simulation of some nature, created by an extra-planar scientist, and there is a big chance everything ocurred by chance.

    To demonstrate you complexity emerging from simplicity, lets make an experiment:

    Take a square board made of 100×100(any size) little squares,
    now each little square is surrounded by eight neighbors, each square can be either on, or offf,and we will give each square the same simple set of rules:

    if an off square is surrounded by three on squares, then it becomes on. if an on square is surrounded by two or three on squares, it keeps on, otherwise, it goes off.

    on each turn, all new cell states are calculated based on the actual state, and then all cells are switched together to next state

    this experiment was created by John Horton Conway in 1970 and is called Conway`s game of life.

    now if you simulate that in software, you can experiment creating seeds, and watch the thing unfold as an animation.

    Conway created these set of rules, he designed these rules, and just the rules, but turned out in his experiments the he observed a large variety of common objects that popped regularly out of the chaos caused by the seed initial “explosion”.

    People then became interested in this pseudo-universe Conway created, and started to study it`s natural behavior, turned out that still today, people are discovering new things in the game of life, the same one, with the same three simple rules, and not simple n-state switchers, but memory blocks, state machines, logic circuitry, things that are a billion times more complex than the simple uderlying rules, including self-replicating particles, Conway never designed those information systems, they ocurred naturally, as a consequence of existence, and not intent. See, the creator created the universe, but the “life” (or information, as you like), emerged naturally, was never designed.

    and if you don`t believe me, here we go.

    http://en.wikipedia.org/wiki/Conway%27s_Game_of_Life

    http://pentadecathlon.com/lifeNews/index.php

    Now imagine that billionth fold complexity applied to the laws of physics, the three dimensions, the plenty of space available, billions of years of iteractions, and the ridiculously large number of particles in the universe, and you will end up with at least a bacteria.

    Assuming god, or a creator really exists:

    1 – it doesn`t interfere in the universe, since it would be measurable, and demonstrable by experiment, wich is not the case.

    2 – since everything in the universe emerged from an initial state (big-bang), and the number of particles in it is veeeery large, god might not even know we`re here on earth, or not know our star is here in this point of milky way.

    3 – since we don`tknow the real nature of the universe or how it`s represented to the creator, we can`t say it even experiences space, time, energy and matter in a way it can understand it as we do.

    Probably we`ll never know if god really exists, but if it do exists, it will never be the bible`s god, and thats science, not guessing, `since the god of the bible is simply scientifically impossible.

    Posted by Cochi | January 9, 2011, 8:09 am
  78. PS.: Dr. Werner Gitt is a young earth creationist, and have published various books on creationism.

    check out one of his scientific articles here:
    http://www.answersingenesis.org/creation/v17/i4/theistic_evolution.asp

    Posted by Cochi | January 9, 2011, 8:30 am
  79. This entire “debate” in summary:
    PG:
    1) I wish to believe on God.
    2) No one can explain everything
    3) Therefore unexplained thing X proves God did it.

    Everyone else:
    1) Not knowing is not evidence of anything.

    Posted by Alex Hardman | January 9, 2011, 8:40 am
  80. Here is a summary of Alex’s constructive contribution to this discussion…

    .

    Posted by PG | January 9, 2011, 1:13 pm
  81. Cochi,

    “Science without religion is lame, religion without science is blind.” -Albert Einstein

    Regardless, you still havent responded to the evolutionary scientists who also refute your science…

    So, to keep you on point, then lets just focus on eminent evolutionary scientists who state the same thing that those pesky creationists are saying about information….

    “Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter… These two domains will never be brought together in any kind of the sense usually implied by the term “reductionism.” …The gene is a package of information, not an object… In biology, when you’re talking about things like genes and genotypes and gene pools, you’re talking about information, not physical objective reality… This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms.”
    -George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995, pp. 42-43

    Posted by PG | January 9, 2011, 1:14 pm
  82. Cochi….

    “This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms.”
    -George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995, pp. 42-43

    This is the problem on this board for the last 2 years, the Atheists refuse to discuss the coded information in DNA on its own terms seperate from its biological medium.

    Q: Why?

    A: It threatens the very core of their materialists views because CURRENTLY we know that all semantical information invokes intelligence not randomness…

    Posted by PG | January 9, 2011, 1:25 pm
  83. Atheists refuse to discuss the coded information in DNA on its own terms seperate from its biological medium.

    No, it’s just not a big deal. And it gets boring after a while, arguing that DNA isn’t evidence for intelligent design. Why do you think it is? Hmm? You have to come up with a better position than quoting crank at us. That’s not gonna convince me.

    Because here’s the thing. The scientists–the people who actually work with this stuff–they don’t think it’s evidence for intelligent design. And the reasons that they give sound pretty credible to me.

    Hell, Frank Collins–a Christian, whose values are not in conflict with a creator–in and interview with Tucker Carlson said that although he does believe there are rational arguments for God, “They don’t come from my field of genomics.”

    Tell me–why did he say that? Does the director of the human genome project not know what he’s talking about? Maybe.

    Or maybe finds the reams and reams of ID crank unimpressive. Perhaps he isn’t one to be persuaded by the mangled reasoning of wannabes like Dembsky and Behe. That could be why he refused to be in Expelled, and why he called it “ridiculous.”

    You can believe the hucksters if you want, PG, but I’m gonna go with the real scientists.

    Posted by Ian | January 9, 2011, 5:26 pm
  84. Ian, on January 9, 2011 at 5:26 pm said:
    “Tell me–why did he say that? Does the director of the human genome project not know what he’s talking about? Maybe.”

    PG says:

    Ian,
    Well lets see what he has to say about DNA.
    Apparently you are unaware of the fact that Dr. Collins wrote a book a year after that interview called the “Language of God”.

    In his book, Collins invokes Intelligent Design in Cosmology and Physics realms, but then stops at the Biology realm and insists that natural evolutionary mechanisms are sufficient.

    I agree more than I disagree with him.

    “For me, as a believer the uncovering of the human genome sequence held additional significance. This book was written in the DNA language by which God spoke life into being. I felt an overwhelming sense of awe in surveying this most significant of all biological texts”(. 123-124).

    “”God is the source of all life and that life expresses the will of God” (p. 203).

    So Ian, Tell me–why did he say that? Does the director of the human genome project not know what he’s talking about? Maybe.”

    .

    Posted by PG | January 9, 2011, 10:40 pm
  85. Can you give us at least one example of this “information” “separate from it`s biological medium”, you have found in the DNA? i understand information as a separate thing from matter, you don`t need to repeat yourself, i`m asking for examples IN THE DNA.

    cause i don`t see where it is, you and your fellow IDers cite it very often, but i never seen a single example.

    Posted by Cochi | January 10, 2011, 9:21 am
  86. Cochi,

    The information in DNA is independent of the communication medium insofar as every strand of DNA in your body represents a complete plan for your body; even though the DNA strand itself is only a sequence of symbols made up of chemicals (A, G, C, T).

    The Courts confirmation:

    “The information encoded in DNA is not information about its own molecular structure incidental to its biological function, as is the case with adrenaline or other chemicals found in the body. Rather, the information encoded by DNA reflects its primary biological function: directing the synthesis of other molecules in the body”

    For almost a year now, I have referenced numerous mainstream scientific publications that support these conclusions.

    Posted by PG | January 10, 2011, 12:38 pm
  87. PG says:
    I am now using this thread as my library of Peer reviewed papaers to support my position that DNA is a lliteral code. Here is the latest paper.

    While atheists continue to claim DNA is not a literal code, science went forward and found many error detection systems, parity codes, and checksums that serve to ensure unwanted mutations do not corrupt the ……wait for it……….CODE!

    Earlier i cited a May 2011 peer reviewed paper. This paper outlines Yockeys DNA code schematics to evidence that DNA is in fact a literal code and in fact has error detection systems. The paper makes some rather shocking conclusions that contradict your claims of mindless stochastic mechanisms.

    Now read the conclusion carefully with the emphasis on 2 words
    1) Learned
    2) communication

    Conclusion
    Effective and secure data transmission remains an ongoing engineering endeavor,
    but biological systems have learned how to efficiently and effectively combine all
    three aspects of communication seamlessly (this includes compression, encryption,
    and error-correction coding)….

    http://www.ece.iit.edu/~biitcomm/research/references/Elebeoba%20E.%20May/An%20error-correcting%20code%20framework%20for%20genetic%20sequence%20analysis.pdf

    Posted by PG | June 15, 2011, 1:16 am
  88. here is another oldie but goodie.

    “The Linguistics of DNA: Words, Sentences, Grammar, Phonetics and Semantics” by Sungchul Ji of Rutgers University – http://www.rci.rutgers.edu/~sji/Linguistics%20of%20DNA.pdf In this paper,
    Dr. Ji explains that human language has 13 linguistic characteristics and DNA has 10 of them. He says cells speak a language called “cellese.”

    The opening sentence of his paper says this:

    “There are theoretical reasons to believe that biologic systems and processes cannot be fully accounted for in terms of the principles and laws of physics and chemistry alone, but they require in addition the principles of semiotics – the science of symbols and signs, including linguistics.”

    The italicized words are his, by the way, not mine. He goes on to say:

    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese, defined as “a self-organizing system of molecules, some of which encode, act as signs for, or trigger, gene-directed cell processes,” and (2) that cell language has molecular counterparts to 10 of 13 design features of human language (humanese) characterized by Hockett and Lyon, thus suggesting an isomorphism between cellese and humanese.”

    Read it again::
    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese.

    and again:
    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese

    and for the hardcore atheists:
    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese.

    Posted by PG | June 15, 2011, 1:24 am
  89. “Code is in the mind of the beholder.”

    We observe (behold) DNA and we learn that its behaves in a way that strikingly resembles computer codes.
    The word “code” is a label that refers to a specific group or series of events. Does the fact that we can describe the observed behaviour of a molecule of DNA in the same way (apparently) we describe intentionally DESIGNED communication systems entitle us to infer that they also have a designer in common?
    Black swan fallacy, maybe?

    I once had the privilege of being teletransported to a remote planet virtually identical to my home planet, Earth. As I strolled through the countryside, I was struck by the fact that there were no birds. No winged insects. Not a single living creature equipped with wings or any other feature enabling flight.
    Apart from that, this other planet seemed identical to my planet earth. The proliferation and variety of civilizations seemed identical. They even had Walmart and Sarah Palin! I assumed there would be a replica of me and set about trying to find me. I did actually end up by finding me, but it was not a happy experience so I shall leave describing that for another day.
    As you will have guessed, they had bikes, and cars and boats and…aeroplanes. But no winged creatures!
    As it happens, I had decided to take my pet parrot, Crickenwat, with me. He doesn’t like being left alone.
    Being a scientist myself, I set up a meeting with other scientists. Obviously, I was obliged to take Crickenwat with me.
    When I removed him from the bag I was carrying him around in, and set him on the table in the bar where we were all meeting up, the others looked at him in wide-eyed amazement.
    “Wow!” they exclaimed in unison, since their language has evolved to same point of sophisticated complexity as in my native Richmond, Va.
    At that point, Crickenwat took off for a swift flight around the bar, in search of peanuts. His fluttering display provoked another round of “Wow!”s. One guy, a design engineer, recovered his aplomb enough to ask me, “How on earth did you design that aeroplane?”
    “It’s not an aeroplane, it’s what we call a bird. It’s a living, squawking, breathing,crapping creature. I didn’t design it. I bought it in a pet shop.”
    “That’s impossible,” the engineer replied. “Everything we know about that flies has been designed. So that thing MUST have been designed. Are you just being modest with us?”
    “No, really, where I come from, animals with the ability to fly just occur in nature, like bugs, mice, elephants and,er, Sarah Palin.”

    Long story short, the engineer guy persuaded me to let him take Crickenwat home with him so that his team could study him more closely.
    When we met up again a few days later, he handed the parrot back to me and said, “It’s much more complex than any plane I’ve ever seen but it shares all the features of a plane which allows for controlled flight. Apart from one apparent design error, which I think we could put right for you – the way it craps all over the place – it so precisely resembles an aeroplane, that we can safely call it an aeroplane. Sure, we haven’t observed it being manufactured, but as serious, peer-reviewed scientists, we can confidently conclude, by inductive reasoning and using the inference to the best explanation, that your parrot IS an aeroplane, and has been designed as an aeroplane.”
    “We have further come to the conclusion that it must be a military device, rather like the drones that we use in warfare, even though we find it’s bombing capacity a little quixotic. Do you guys really crap the enemy to death?”

    P1 A parrot has wings and flies.
    P2 All winged, flying objects that we know are designed aeroplanes.
    C Crickenwat is a designed aeroplane.

    Oh, just one thing. I lied about one detail in the above story. Crickenwat isn’t a parrot.
    He’s a swan.
    And he’s black.

    Posted by Richard Morgan | November 12, 2011, 5:40 am
  90. Richard,

    The basis of your position is that perhaps one day we can discover a planet where information does not require a mind, Non-belief in God must surely rest on a sort of faith that such a process exists and will be discovered someday however everything that we presently know about information and DNA requires a Mind, Is there such a process? All we can say is that none has ever been discovered. No known exception exists. We can say that information never comes from naturalistic process in the exact same way that we say that there are no exceptions to the laws of thermodynamics, or the law of gravity, or the speed of light.The fact is that current scientific convention offers no known mechanism by which natural processes produce information. So for you to say right now that there is an exception is to make a patently unscientific statement.

    Regardless of your reluctance to accept premise #1 “DNA is a code” .Here is the current scientific evidence:

    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese, defined as “a self-organizing system of molecules, some of which encode, act as signs for, or trigger, gene-directed cell processes,” and (2) that cell language has molecular counterparts to 10 of 13 design features of human language (humanese) characterized by Hockett and Lyon, thus suggesting an isomorphism between cellese and humanese.”
    “The Linguistics of DNA: Words, Sentences, Grammar, Phonetics and Semantics” by Sungchul Ji of Rutgers University – http://www.rci.rutgers.edu/~sji/Linguistics%20of%20DNA.pdf

    Lets review:
    1) DNA is a literal code (A scientific fact)
    2) All known codes are designed. (A repeatable observation )
    3) DNA is proof of design.

    The origional syllogism should be easy for you to disprove Richard. Just to clarify, all you need is to do is provide empirical evidence of a naturally occuring code in our reality and not just in your fantasies…

    Posted by PG | February 19, 2012, 11:50 pm
  91. PG said :
    1) DNA is a literal code (A scientific fact)
    2) All known codes are designed. (A repeatable observation )
    3) DNA is proof of design.
    The original syllogism should be easy for you to disprove Richard.

    Alas, it would seem that you do not know what a syllogism is. Your three points do not constitute a syllogism, since you change the category in 2).
    This is a syllogism;
    P1 DNA is a code;
    P2 All codes are designed;
    C : Therefore DNA is a code.

    As soon as you change the category from “code” to “known codes” you have broken the logic of a syllogism. You can appeal to inductive reasoning if you wish, but please don’t call it a syllogism. Black swan fallacy.

    If you want to stick with “known codes” you are obliged to include an extra piece of information – designed by whom?
    I presume you dare not do this because you would then end up with:
    P1 : DNA is a code;
    P2 : All known codes are designed by human intelligence;
    C : DNA was designed by human intellilgence.

    Doesn’t really work, does it?

    Posted by Richard Morgan | February 20, 2012, 4:42 am
  92. Correction ( I can’t seem to be able to edit or delete the previous comment.)

    PG said :
    1) DNA is a literal code (A scientific fact)
    2) All known codes are designed. (A repeatable observation )
    3) DNA is proof of design.
    The original syllogism should be easy for you to disprove Richard.

    Alas, it would seem that you do not know what a syllogism is. Your three points do not constitute a syllogism, since you change the category in 2).
    This is a syllogism;
    P1 DNA is a code;
    P2 All codes are designed;
    C : Therefore DNA is designed.

    As soon as you change the category from “code” to “known codes” you have broken the logic of a syllogism. You can appeal to inductive reasoning if you wish, but please don’t call it a syllogism. Black swan fallacy.

    If you want to stick with “known codes” you are obliged to include an extra piece of information – designed by whom?
    I presume you dare not do this because you would then end up with:
    P1 : DNA is a code;
    P2 : All known codes are designed by human intelligence;
    C : DNA was designed by human intellilgence.

    Doesn’t really work, does it?

    Posted by Richard Morgan | February 20, 2012, 4:46 am
  93. Richard,

    For the sake of discussion, Ill clarify it for you to save time and effort:

    1) DNA is a code
    2) All codes that we know the origin of come from a mind.
    3) Therefore DNA came from a mind!.

    All you need is one empirical example of a code or langage that occurrs naturally…

    Good luck!

    Posted by PG | February 20, 2012, 1:15 pm
  94. “Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter… These two domains will never be brought together in any kind of the sense usually implied by the term “reductionism.” …The gene is a package of information, not an object… In biology, when you’re talking about things like genes and genotypes and gene pools, you’re talking about information, not physical objective reality… This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms.”
    -George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995, pp. 42-43

    And yet today, atheist still insist that DNA code are just chemicals reacting and cannot admit that DNA code is real information! Why am I not suprised?

    Posted by PG | February 28, 2012, 1:51 am
  95. PG says : “And yet today, atheist (sic) still insist that DNA code are(sic) just chemicals reacting and cannot admit that DNA code is real information!”
    ” DNA code is real information”!!!
    A code is not information, it is a predetermined set of symbols used to transmit information, just like a language.
    This sentence is not a language, it is using a language (mostly English) to communicate the information that PG has just shot himself in the foot with his latest gaffe.
    DNA is a molecule.
    The arrangement of its component parts evokes code-like characteristics.
    The set of symbols is limited to four – T,G,A,C.
    These symbols, plus the protocol of their organisation would be the “code”.
    But DNA itself is not a code any more than a book is not a language or …—… is not the Morse code.
    DNA appears to use a code/language.
    Is all.

    Posted by Richard Morgan | February 29, 2012, 1:21 am
  96. Richard Says:

    A code is not information, it is a predetermined set of symbols used to transmit information, just like a language….
    DNA is a molecule.
    The arrangement of its component parts evokes code-like characteristics.
    The set of symbols is limited to four – T,G,A,C.
    These symbols, plus the protocol of their organisation would be the “code”…..
    DNA appears to use a code/language.
    Is all.

    BANG!

    Why thank you Richard. You have provided a definition of what constitutes a code, and why the sequence of base pairs in DNA meets your definition of a code!

    Posted by PG | February 29, 2012, 11:14 pm
  97. P1 – Code is created by a humans
    P2 – Humans perfect their code by checking for errors in the code
    P3 – Code that has no errors has been perfected
    C1 – Perfect code can be created by humans

    P1 – DNA is said to be a code
    P2 – DNA has errors
    P3 – DNA is not perfected
    C2 – DNA is not created code

    P1 – There is a theory which was called “The Big Bang” for non-scientific individuals
    P2 – Big bangs make loud noises
    P3 – There was no loud noises during “The Big Bang”
    C3 – “The Big Bang” is not an explosion

    P1 – DNA was explained to non-scientific individuals as being code
    P2 – The term code is used by “creationists” has proof their god exists
    P3 – Needing proof of anything means you don’t have faith in it.
    C4 – “Creationists” who need proof of their god’s existence have no faith in their god

    P1 – “Creationists” want DNA to be code so they can prove their god exists.
    P2 – If DNA is code that was created then it must be from a “god” or a “creator”
    P3 – “Creationists” have not provided proof it was their “god”.
    C5 – Their “god” did not create DNA because they have not provided proof that their god exists.

    Posted by digitalbeachbum | April 10, 2012, 10:46 pm
  98. @ digitalbeachbum :- My, oh my – what a ghastly failure to understand logic.

    Posted by Richard Morgan | April 13, 2012, 8:51 pm
  99. LMAO – sure thing Richard. Please enlighten us all with your logic

    Posted by digitalbeachbum | April 17, 2012, 1:10 pm
  100. @digitalbeachbum,
    Richard is being kind to you. Let me enlighten you. Your attempt at logic and understanding of DNA is so fucked up that its embarrassing. You should simply quit while your behind and just slip back into obscurity.

    Posted by PG | April 19, 2012, 2:30 am
  101. HAHAHAHAHAHA I’m still waiting. Instead of flapping your mouth please post a rebuttal filled with facts rather than that dribble from your lip.

    Posted by digitalbeachbum | April 19, 2012, 6:00 am
  102. OK. How about we start with your assertion that DNA is not a code. Here is what world-renowned biophysicist Werner R. Loewenstein has to say on this matter:

    “A code is a set of rules governing the order of symbols in communication. This defines a code, regardless of the nature of the symbols, be they alphabetic letters, voice sounds, dots and dashes, DNA bases, amino acids, nerve impulses, or what have you.” The Touchstone of Life: Molecular Information, Cell Communication and the Foundations of Life, by Werner R. Loewenstein, Oxford University Press, 1999

    .
    Why would his Oxford Peer Reviewed publication be wrong, and you be right?

    .

    Posted by PG | April 19, 2012, 9:55 pm
  103. The use of the word “code” is a misnomer. It is no different than people calling “The Big Bang” an explosion. It wasn’t a “BANG” it was an “EXPANSION”. Are “driveways” places to drive your car? Are “parkways” a place to park your car? Is “pencil lead” true or is it now graphite? What about “head cheese”? or “Guinea pigs”?

    The definition of the word “code” used above is an incorrect definition. “A code is a system of words, letters, figures, or other symbols used to represent others, esp. for the purposes of secrecy.” But this leaves several serious issues for theists who want this “holy grail” to be their empirical evidence for their god existing. If it is code then what language is being converted to code?

    Also to consider, if it is “god’s language” which god is it? There are a dozen or more currently actively worshiped gods today (and there might be more). So which god is it? Why your god? Why their god? Why not an advanced alien race from another galaxy or solar system?

    As for any scientist who uses the word “code”, it is because it is for lack of a better word to describe the transfer of genetic material. Even my brother who is a head researcher/PhD/professor in the field calls it code. When I asked him why he used the word code he explained that it is what is widely accepted and it would be difficult for the community to change the word now that it is established. He does not believe it is a “code” as in a “computer program” nor is it a “code” as in “Morse code”.

    While this scientist you mentioned has a few books out and his information and the way it is presented is awesome, It does not prove that there is 1) a DNA language 2) that DNA is a code 3) that your god exists 4) that any god exists 5) that if DNA is a chemical code which does not have a DNA language or purpose, that it was designed by any god or any space alien.

    Posted by digitalbeachbum | April 20, 2012, 12:47 pm
  104. “The definition of the word “code” used above is an incorrect definition”- digitalbeachbum

    Gee your basically stating that one of the worlds most eminent scientists in the world on such matters of defining DNA as a code is wrong because you and your brother say so. Im not impressed!.

    It seems you exchanged Loewensteins MORE RIGOUROUS definition of a code for the Oxford Dictionary definition of “Code” but then you slyly left out Oxfords other sub-defintions of code, that are inclusive of Oxfords definition of code, especially the definition of Genetic code:

    CODE:

    Pronunciation: /kōd/
    noun
    •1a system of words, letters, figures, or other symbols substituted for other words, letters, etc., especially for the purposes of secrecy: the Americans cracked their diplomatic code sending messages in code
    • a system of signals, such as sounds, light flashes, or flags, used to send messages: Morse code

    • a series of letters, numbers, or symbols assigned to something for the purposes of classification or
    identification: the genetic code.

    So according to your dictionary source, Genetic code is a synonymous cross-reference to the word “Code”

    Unfortunately for those persons who argue that the use of the word code is incorrect and cite dictionarys,do not even know that the Respectable Dictionaries such as Oxford and Merrimann-Webster actually go out of their way to state that the use of the word “code” in biology is synonymous with the definition of the word “code”, and not identify it as metaphorical or misnomer.

    Let me provide another Peer Reviewed publication from another world renowned scientist who pioneered the scientific field of Bioinformatics:

    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    Posted by PG | April 20, 2012, 4:07 pm
  105. BTW, Over the last 2 years on this blog, I have never made representations that DNA code is proof of a god, but only that it is evidence of design.

    Posted by PG | April 20, 2012, 4:49 pm
  106. And again, here is scientific evidence from Rutgers university confirming that DNA is a language…

    “Recently it was postulated that language is more than just a metaphor and that linguistics provides a fundamental principle to account for the structure and function of the cell. The conclusion is supported by the facts that cells use a language, called cell language or cellese, defined as “a self-organizing system of molecules, some of which encode, act as signs for, or trigger, gene-directed cell processes,” and (2) that cell language has molecular counterparts to 10 of 13 design features of human language (humanese) characterized by Hockett and Lyon, thus suggesting an isomorphism between cellese and humanese.”
    “The Linguistics of DNA: Words, Sentences, Grammar, Phonetics and Semantics” by Sungchul Ji of Rutgers University – http://www.rci.rutgers.edu/~sji/Linguistics%20of%20DNA.pdf

    Posted by PG | April 20, 2012, 4:53 pm
  107. The term for genetic code was invented by humans.

    “The structure of DNA was discovered by James Watson and Francis Crick. George Gamow postulated that a three-letter code must be employed to encode the 20 standard amino acids used by living cells to encode proteins. With four different nucleotides, a code of 2 nucleotides could only code for a maximum of 42 or 16 amino acids. A code of 3 nucleotides could code for a maximum of 43 or 64 amino acids.”

    Crick, Francis (1988). “Chapter 8: The genetic code”. What mad pursuit: a personal view of scientific discovery. New York: Basic Books. pp. 89–101.

    Oh wait, you take words literally. So that must mean the “building blocks of DNA” (which are Nucleotides) must mean that the Freemasons are tied in to the creation of life which.. OH MY! brings us to the Illuminati!!!! OH MY… this is truly a conspiracy!

    And let us not forget the process of “transcription” and “translation”! You know??? The processes that are involved in making proteins from our genes!!!! Did you know that GENES can transcribe and translate languages? MY MY MY they are awfully intelligent little buggers aren’t they?

    AND! I almost forgot, GENE EXPRESSION! YES GENE’S CAN HAVE EXPRESSION! OH MY OH MY OH MY! They can smile and frown and jump up and down! Quite amazing!

    YES YES YES! I see the light now! Jesus is real and so is god and the virgin mary and adam and eve, the talking snake, the talking donkey and the ogre who lives in the swamp!

    Oh wait, that’s right. You hide behind intelligent design to make yourself sound scientific and logical. Bet you are one of those “young earth” believers huh? yep.. uh-huh. god, creator, intelligent design, aliens from other galaxies. Whatever.

    And thanks for that last article supporting my conclusion that mankind is the one who invented the genetic code. Yet again I am triumphant against ignorant creationists who think science will prove their faith in their god. HAHAHAHA!

    Posted by digitalbeachbum | April 20, 2012, 7:46 pm
  108. “The term for genetic code was invented by humans” – Digitalbeachbum.

    Oh for the love of Marx, are you really that retarded? Humans discovered a code within the genome and called it a code! In fact you stepped on your dick with your citation from Crick and Gamov because they actually demonstrates the efficiency of the three letter DNA code!

    Here, maybe if you will accept the factual truth if it came from your own High Priest Richard Dawkins

    “Every single one of more than a trillion cells in the body contains about a thousand times as much precisely-coded digital information as my entire computer… “Each nucleus, as we shall see in Chapter 5, contains a digitally coded database larger, in information content, than all 30 volumes of the Encyclopaedia Britannica put together. And this figure is for each cell, not all the cells of a body put together.” – Richard Dawkins, The Blind Watchmaker

    digitalbeachbum says: “nooooooooooooooooo not Dawkins too!!!!”

    Posted by PG | April 21, 2012, 12:41 am
  109. LMAO!!! Really? This is all you have? A bunch of people referencing the word code to explain the functionality of DNA. So this makes you believe that an intelligent designer made DNA, made life, made the earth,…. etc. Alrighty then!

    HAHAHAHAHAHA! You faith lacking slacker. You have no faith in your god so you need to grasp at straws as they come along to prove not to us, but to prove to you that your god exists. Sure use the “intelligent design” label any way you want! As I have mentioned previously you hide from your faith because it is weak. Oh how I wish there was a god so I could watch you suffer. You’re the type who gets tossed in to the lake of lava to suffer for eternity. It is you who has heard the word of your god but you refuse to accept! HAHAHAHAHAHA!!!!

    You want to use “code” for DNA. Fine. But what is worse is you want it to be a language. You want it to be intelligent. Talk about retarded. Don’t you get it? Before DNA it was the religious people talking about how if it wasn’t for the moon being where it was we wouldn’t have the tides, so “god” must have put it precisely there. Then there was the distance from the Sun which put the earth in the “goldilocks zone”, before that it was “sea shells at the top of Mt. Everest prove the Noah’s ark story, then it was human eye was too perfect to be an accident, then the human ear was too perfect…. the list goes on and on…

    The problem with you idiots is that you keep jumping from life raft to life raft instead of learning to swim. You make excuses for your faith rather than have actual faith.

    You have been weighed, you have been measured and you have been found wanting.

    Posted by digitalbeachbum | April 21, 2012, 10:50 am
  110. “A bunch of people referencing the word code to explain the functionality of DNA” -digitalbeachbum

    Those “bunch of people” are called world renowned scientists who have provided peer reviewed empirical evidence that DNA is a digital code and that it has language qualities. And yes, there are bunches of them!

    The fact that you cannot provide a single scientific publication that supports your position speaks volumes. The fact that you go on personal attacks shows you also have no ideas.

    Here is what you can do..

    There is this very large emerging field of science called Bioinformatics (Biology + Information Theory) that was pioneered by Yockey and his theory that DNA is a real code. Why dont you communicate to all those thousands of scientists and their Oxford Peer Reviewed Jpurnals that all these years they have been wrong, that DNA really is not a code, and they are completely delusional! Im sure they would be totally grateful for your insights…

    or better yet,..

    Why dont you just take your asswhipping like a man and just go away.

    Posted by PG | April 21, 2012, 1:32 pm
  111. BTW, Im not a Bible Creationist you Dumbfuck!

    Posted by PG | April 21, 2012, 1:34 pm
  112. You want to use “code” for DNA. fine. But what is worse is you want it to be a language – digitalbeachbum

    That was one of many scientific papers that evidence that DNA is a language, therefore its science that want it to be a language, not me! Im just taking it to its logical conclusions.

    However, I do understand the ramifications these scientific discoveries have on smashing your world views to smithereens. but thats your problem, not mine!…

    Posted by PG | April 21, 2012, 2:41 pm
  113. I don’t need to prove anything about DNA being code or not being code. It doesn’t matter. I’ve already said go ahead and use it as code. It doesn’t change the truth. I’ve realized your position. You are a person who doesn’t have a single drop of faith in your “god”. You hide behind this “intelligent design” bullshit and present it to every one as your proof that “something made us”. In reality you have yet to prove anything. You have avoided my questions about “which god” or excuse me… “which intelligent designer” created DNA. Was it a god? or was it little green men from Mars? Really. Get a grip on life. There is no god. There never was and for that matter this world hasn’t heard a peep from any “gods” since 2,012 years ago. As soon as we found science and industry “god” suddenly disappeared. POOF! like a fart in the wind. Never to be heard from again until the next time humans go in to the Dark Ages.

    Posted by digitalbeachbum | April 22, 2012, 9:45 pm
  114. ‘I’ve already said go ahead and use it as code”- digitalbeachbum

    Great! Which now brings us to your origional post where you applied your logic that all codes are created!

    Posted by PG | April 23, 2012, 12:24 am
  115. Only a deluded fool would seek to prove DNA isnt a code. Code is just a word anyway, that can be interpreted in many different ways. DNA is a language of some kind, as well as Junk DNA, their sequence has already been proven to be build following the universal rules of synthax found in every language on the planet, that is a fact. I m not atheist, I m not religuious, but trying desperately to “prove” there isnt a “god” or any Intent or order in ANYTHING is something Science has been at for a while now, and I find it both useful and funny. I personally like Crick’s view about it, does it seem like it was created by random collision of matter overtime? NO. Is it mathematically Impossible to be natural? Yes.This thing looks like a machine and behaves like one. To think it’s natural is like looking at you car and assuming it just build itself by bits pushed randomly by the wind. DNA might have been designed by who-knows for whatever reasons – if any – just get over it people.

    Posted by Sanji | April 23, 2012, 3:55 am
  116. I forgot to add, our current knowledge of DNA is based of the studies of about 3% of its sequence because “Junk DNA” isnt well understood as to what is its purpopse and function. Actually I believe our great Scientific priesthood called it this ways because of their lack of undertsanding of it, and because they think it has no function (ahahahahah). So keep that in my mind everybody, when ANYONE speaks of DNA, we’re speaking of 3% of it, not more than that. I wouldnt write a book about America if I had just a poo in JKF Airport’s toilets, so talking about it sure is fun, but that’s it….lets not jump to conclusion

    Posted by Sanji | April 23, 2012, 7:30 am
  117. You are still hiding behind the “intelligent design” crap.

    Posted by digitalbeachbum | April 23, 2012, 1:09 pm
  118. Digital, you said “go ahead and use it as code,” and you stated in your first post that all codes are created! There really is nothing more to discuss…

    Posted by PG | April 23, 2012, 2:35 pm
  119. PG, DNA being a language, or code, as you like, is not really connected with that intelligent design claim you make, and the main diffeence between a code that is designed and DNA is that with any designed code you could switch symbols and make a new ruleset to mirror that changes and the code would still be the same functional code, DNA can never work if you switch its proteins, and this is because the very ruleset for it to work are the laws of physics, and DNA is a self organizing chemical structure, being so, evolution is intrinsic to it, and it must have started as a really smaller particle and then over billion years, evolve into something like us. i know you don`t believe random mutation + selective pressure + time can improve things and “create information”, but here is proof: http://boxcar2d.com/
    this is a simple program in flash that uses physics simulation + a genetic algorithm that blindly generates a prism with possible wheels, the area of the prism is related to the torque in the wheels, if there are any. the selection funtion how long the individual goes in the randomly generated track before dying or stucking, the higher the score in the 20 individuals generation the higher the chance to reproduce for the next generation, and that`s it, just like nature, if you leave this program for a few hours maybe, you will see a car, perfectly fit for the track, that is generated through a code just like DNA and never has been designed, it`s nothing like you IDers are used to say about random letters thrown in the air and a book magically formed, that`s more like faith works, not science.

    Posted by Cochi | April 23, 2012, 3:11 pm
  120. “i know you don`t believe random mutation + selective pressure + time can improve things and create information” – Cochi

    I believe non-random informational processes + selective pressure + time can improve things and add information!

    Consider the following. Ill use an anology from Meyers book and Mosh Avericks exlaination:.

    “Meyer points out a rather astonishing fact – about which there is no scientific controversy – regarding the arrangements of the nucleobases in DNA. There are absolutely no chemical affinities or preferences for which nucleobases bond with any particular phosphate and sugar molecule. The N-glycosidic bond works equally well with (A), (T), (G), or (C). And secondly, there are also no chemical bonds in the vertical axis between the nucleobases. What this means is that there are no forces of physical/chemical attraction and no chemical or physical law that dictates the order of the nucleobases; they can be arranged in a nearly infinite amount of different sequences.

    Imagine a series of magnetic letters on the metal door of a refrigerator. All the letters are attached to the door by the same bond, namely a magnetic attraction. However, while the magnetic attraction is identical, there is nothing at all about the structure of any particular letter, or the magnetic bond, that would determine a preference for the order in which the letters are arranged on the door.

    If the letter G must always follow L which must always follow C, etc, then all you would get would be an endlessly repeating pattern of C, L, G etc., and no information could be conveyed. In fact, it is this very indeterminate nature of the arrangements of letters which allows them to convey functional information. Similarly, the arrangement of letters on a printed page has nothing at all to do with the chemical composition of the ink or paper. Meyer shows that the same applies to the arrangement of the letters of the genetic text. What allows the storage of encyclopedic amounts of information in DNA is the very indeterminate nature of the arrangements of the nucleobases, which are the “letters” of the genetic text.

    Meyer makes this point in critique of what are called “self-organizational scenarios,” one of the main naturalisitc approaches to explaining the origin of life and the ultimate origin of biological information. These theories attempt precisely to explain the ultimate origin of biological information by reference to chemical bonding affinities or some physical or chemical law. Meyer demonstrates decisively why these theories cannot work; they fail to explain the basic facts of DNA chemistry and they fail to appreciate the non-redundant, non-repeating nature of functionally specified information. As he explains, laws by definition describe repeating patterns of redundant order. They do not describe aperiodic information-rich complex sequences. Yet, as he notes, the base sequences in functional sections of DNA are not highly repetitive. DNA contains a set of functional biochemical instructions, not an endlessly repeating mantra. A law might generate the latter, but can’t accurately describe or explain the former.”

    Posted by PG | April 23, 2012, 5:57 pm
  121. this is not what i said PG, i never said you cannot rearrange molecules in a DNA sequence, i know nucleotides can bond to any other one, i just said if you do so, that sequence will never “translate” to the same individual as before, as in any code that is DESIGNED and can be MODIFIED, and if you’re saying that no chemical reaction occurs in the DNA to form our proteins, then you’re saying DNA does nothing, god tells the cells which protein to produce in which quantites, and the cells do so by magic? PG, it`s obvious that the way DNA works to synthesize protein is by chemistry, or do you believe in magic? have you even bothered checking my link?
    By the way, rules CAN generate highly complex structures, read Stephen Wolfram`s book, A New Kind of Science.

    Posted by Cochi | April 23, 2012, 6:28 pm
  122. Mr. Digital, don’t bother trying to discuss this subject with PG. It’s an obvious waste of time for any one to try and talk sense in to a person who isn’t rational or logical. Did you notice that they have been posting on this blog since March of 2010, trying to convince others that they know what DNA is? That is over two years worth of stupidity and ignorance.

    I also want you to know that I didn’t post that other message, it was someone pretending to be me.

    Posted by Richard Morgan | April 23, 2012, 7:33 pm
  123. “I also want you to know that I didn’t post that other message, it was someone pretending to be me”.
    Posted by Richard Morgan | April 23, 2012, 7:33 pm

    OMG, What a lying piece of shit you turned out to be. Just man up that you got your your asswhooped and get the fuck out! “it was someone pretending to be me” What a dumbfuck! Maybe you have multiple personalities you dumb shit! I cant believe someone would use such bullshit excuses for their ignorance and incompetence!

    Since the “Someone pretending to be me ” actually tied their account to their facebook account, we can conclude that the fraud is you!!

    So get the fuck out!

    .

    Posted by PG | April 23, 2012, 10:51 pm
  124. Cochi,
    I remember watching his Ted talk, when he was demonstrating his awesome search engine. His premise is and I quote “the universe is base, computational”.
    Ok. So If the universe is base computational, then who is the programer? He defaults to multiverse theory as to the origin of information..Puleese! However, It seems to be in line with Shapiro’s “Natural genetic Engineering” in which Shaprio states that the cell has “Cognition” so Im open to both theories.

    I am suprised you cite him when he is against adaptation and natural selection.

    “Biological systems are often cited as supreme examples of complexity
    in nature, and it is not uncommon for it to be assumed that their
    complexity must be somehow of a fundamentally higher order than other
    systems. And typically it is thought that this must be a consequence
    of the rather unique processes of adaption and natural selection that
    operate in biological systems. … what I have come to believe is that
    many of the most obvious examples of complexity in biological systems
    actually have very little to do with adaption or natural selection.”

    –Stpehen Wolfram, _A New Kind of Science_, p. 383

    It seems me and Stephan agree on that point! ; )

    Posted by PG | April 23, 2012, 10:54 pm
  125. BTW Cochi,
    BTW, In the last 2 years on this subject, I never ever, ever, ever, ever, ever, ever, ever, ever, ever, ever, ever ,took a position of “irreducible complexity.” with “DNA is a code” so the idea of simple to complexity is irrelevant when the central point is to account for the origin of information. Wolfram states the information came from another universe is definitely speculation and a stretch of the imagination. So regarding DNA Information, you dont seem to see the challenges for its origination, so lets try again:

    “Instead, the living cell is best thought of as a supercomputer – an information processing and replicating system of astonishing complexity. DNA is not a special life-giving molecule, but a genetic databank that transmits its information using a mathematical code. Most of the workings of the cell are best described, not in terms of material stuff – hardware – but as information, or software. Trying to make life by mixing chemicals in a test tube is like soldering switches and wires in an attempt to produce Windows 98. It won’t work because it addresses the problem at the wrong conceptual level.” Paul Davies

    Craig Venter stated: “Life is a DNA software system and if you change the software, you change the species,”

    You see Cochi,
    I keep communicating it in so many ways, you cannot solder switches to make a software program, just as you cant expect the laws of physics and chemistry to produce words, sentences, and complete instructions from magnetic letters on a refrigerator without intent and purpose. The information in DNA most definitely needs to be addressed and unfortunately even Stephen Wolfram doesn’t adequately account for it.

    Posted by PG | April 23, 2012, 11:36 pm
  126. P1 – Science uses codes to help better understand nature
    P2 – DNA has a genetic code which helps science better understand it.
    C1 – Genetic code was invented by scientists

    Posted by PG | April 25, 2012, 7:13 pm
  127. (revised argument)

    P1 – Scientists create codes to help people better understand nature.
    P2 – DNA has genetic code which helps us better understand the nature of DNA.
    C1 – Genetic code was invented by scientists.

    Posted by PG | April 26, 2012, 4:17 am
  128. Isn’t it funny that James Watson and Francis Crick (the men who postulated and discovered DNA) are both Atheists?

    Yep, that’s really funny.

    Posted by PG | April 26, 2012, 4:38 am
  129. (revised argument)

    P1 – All codes are created by humans
    P2 – DNA has a genetic code
    C1 – Genetic code was created by humans

    Posted by PG | April 26, 2012, 5:00 am
  130. IT SEEMS THAT I SHOVED SCIENCE SO FAR UP SOMEONES ASS THAT THEIR ONLY RESPONSE IS TO PRETEND THEY ARE ME. THAT IS THE HIGHEST FORM OF FLATTERY! EACH NEW FRAUDULENT POST PROVES JUST HOW BANKRUPT THEIR POSITION IS, AND JUST HOW RETARDED THEY REALLY ARE…

    KEEP THEM COMING DUMBSHIT, THEY ARE WONDERFUL REMINDERS OF JUST HOW MUCH I FUCKED YOU UP SO BAD!!!

    I LOVE IT,

    Posted by PG | April 26, 2012, 10:55 am
  131. You have a foul mouth and an ignorant mind.

    Just because my initials happen to be the same as the ones you are using doesn’t mean I need to change my name to satisfy your over inflated ego. Besides, I never made any claim as to being you nor did I make any references to your previous posts. Far be it from me to want to even pretend to be you .

    Please disprove my post as I have disproved your previous posts instead of acting like a frustrated old sailor who didn’t get shore leave because he didn’t pass muster.

    Of your other posts you are incorrect about the definition of the word code. Webster dictionary does not define ‘code’ as being ‘genetic code’. It instead provides a link to a compound word such as ‘genetic code’. If you were using a paperback version of the dictionary it would say, “see genetic code”.

    Code itself comes from a Latin word, ‘codex’ which was a “tree trunk” or “block of word”. Romans used tablets of wood to write down information. From this you later get ‘codex’ which is book bound by thread and has a hard cover. Code has several definitions which all pertain to similar meanings, law, morality, secrecy and computers.

    DNA does contain a code, it had to be invented first. DNA has the following definition:

    – any of various nucleic acids that are usually the molecular basis of heredity, are constructed of a double helix held together by hydrogen bonds between purine and pyrimidine bases which project inward from two chains containing alternate links of deoxyribose and phosphate, and that in eukaryotes are localized chiefly in cell nuclei
    (Webster dictionary)

    I don’t see any use of the word code or encoded or language, though previous posters tried to explain to you that the use of the word code is called a misnomer, you refuse to except it because you need genetic code to exist with out human intervention.

    This however is an impossibility since the genetic code you desire to hold on to was created by Crick, Watson and Gamow who were part of the RNA Tie Club. They invented ‘genetic code’ and applied the names, labels, letters and created the first tables for prediction of the outcome of the chemical process.

    Try as you must to disprove me, but it will show your ignorance and stupidity which is based in religion. I can not be defeated. I have history and science on my side.

    I feel compassion for you. I wish you the best and I hope you live a happy and prosperous life.

    Posted by PG | April 26, 2012, 4:02 pm
  132. @THE NEW PG…

    WHATEVER PG!
    IM TYPING IN CAPS SO READERS CAN DIFFERENCIATE BETWEEN US.

    FIRST LETS COMPARE YOUR SYLLOGISMS TO DIGITALBEACHBUMS. WHAT A COINCIDENCE THAT THEY ARE BOTH THE SAME!!! HMMM! ANYWAYS, LETS CONTINUE SHALL WE.

    P1 – All codes are created by humans
    P2 – DNA has a genetic code
    C1 – Genetic code was created by humans
    Posted by THE NEW PG | April 26, 2012, 5:00 am

    YOU ARE STATING THAT ACCORDING TO LOGIC, DNA CODE WAS CREATED, NOT EVOLVED!

    IM IN AGREEMENT!

    Posted by PG | April 26, 2012, 7:07 pm
  133. “Isn’t it funny that James Watson and Francis Crick (the men who postulated and discovered DNA) are both Atheists?”
    Posted by THE NEW PG | April 26, 2012, 4:38 am

    @NEW PG:
    ISNT IT FUNNY THAT CRICK CONCLUDED THAT DNA WAS CREATED BY A MIND (DIRECTED PANSPERMIA)

    Posted by PG | April 27, 2012, 11:51 am
  134. Please provide a direct quote from Crick. I find no such quote from him.

    I know he had a hypothesis that aliens could have had a hand in planting DNA here, but he never said that “yes, aliens did create DNA and they did plant DNA on this planet.

    Posted by PG | April 27, 2012, 2:31 pm
  135. @NEW PG

    WAY TO TRY AND WEASEL OUT OF THE FACT THAT YOU REFERENCED A ESTEEMED SCIENTIST WHO HYPOTHESISED IN A BOOK (LIFE ITSELF) THAT DNA WAS A CODE THAT WAS CREATED BY INTELLIGENT AGENCY!
    .

    Posted by PG | April 27, 2012, 4:02 pm
  136. SO LETS SUMMERIZE:
    FIRST YOU PRESENT A SYLLOGISM THAT ACTUALLY CONCLUDES THAT DNA IS A CREATED CODE

    AND THEN SECONDLY, YOU IMMEDIATELY FOLLOW IT UP WITH A SCIENTIST WHO BELIEVES DNA WAS A CREATED CODE.

    FOR SOMEONE ARGUING THAT DNA EVOLVED AND WAS NOT CREATED, YOUR DOING A STELLAR JOB…

    “SNICKER”…..

    .

    Posted by PG | April 27, 2012, 4:10 pm
  137. You are avoiding the question. Please provide a direct quote stating that Crick said DNA was was created. Please provide the source, otherwise what you said was purely your opinion.

    Also please provide the evidence which proves Crick was correct. Crick was an atheist which rules out a god. He made a hypothesis that aliens could have launched rockets out in to space and that those rockets brought the DNA here to Earth. He didn’t say, “Yep, aliens brought DNA here to Earth and here is my proof”.

    You argument, which you posted previously is false. My argument is at least correct in the sense the DNA code or genetic code was created by scientists to better follow/understand DNA and the chemical process. I did not agree that a god made it nor do I agree that aliens brought it to Earth.

    I now understand why so many people quit discussing the subject with you. So with that being said, I’ll give you one more chance to prove your argument or disprove mine. Either way you will need to provide factual evidence which either supports your side or disproves mine.

    Posted by PG | April 28, 2012, 7:42 pm
  138. @NEW PG

    SURE, FIRST LETS START WITH YOUR WEBSTER DICTIONARY DEFINITION OF CODE:

    “Webster dictionary does not define ‘code’ as being ‘genetic code’. It instead provides a link to a compound word such as ‘genetic code’. If you were using a paperback version of the dictionary it would say, “see genetic code”.”
    – Posted by NEW PG | April 26, 2012, 4:02 pm

    YOU SHOULD OF FIRST ASKED YOURSELF WHY WEBSTERS WOULD LIST GENETIC CODE UNDER CODE AS A SUB DEFINTION OF CODE IF WEBSTER DIDNT THINK GENETIC CODE WAS ACCUALLY A REAL CODE. ALAS, WHAT YOU DONT KNOW IS THAT GENETIC CODE IS LISTED UNDER CODE IN CAPITAL LETTERS WHICH INDICATES THAT “GENETIC CODE” IS SYNONYMOUS WITH “CODE”. WEBSTER DEFINES SYNONYMOUS AS “having the same connotations, implications, or reference”.

    ACCORDING TO WEBSTERS THIS INDICATES:
    “A synonymous cross-reference indicates that a definition at the entry cross-referred to can be substituted as a definition for the entry or the sense or sub sense in which the cross-reference appears”

    http://www.merriam-webster.com/dictionary/code (See Genetic code in capital letters)

    SO EVEN YOUR WEBSTER DICTIONARY REFERENCE CITES DNA HAS HAVING A CODE!

    Posted by PG | April 29, 2012, 12:11 am
  139. @NEW PG

    LETS START WITH YOUR 4TH AND FINAL revised argument:

    P1 – All codes are created by humans
    P2 – DNA has a genetic code
    C1 – Genetic code was created by humans
    Posted by the NEW PG | April 26, 2012, 5:00 am

    YOUR PREMISE #1 IS NOT TRUE,
    A CODE IS DEFINED BY WEBSTER AS “A system of symbols for communication”

    ALL ANIMALS IN THE ANIMAL KINGDOM COMMUNICATE WITH CODES THAT WERE NOT CREATED BY HUMANS AND INFACT MANY WERE COMMUNICATING BEFORE HUMANS EVOLVED, THEREFORE YOUR PREMISE #1 IS INCORRECT!

    WHAT IS CORRECT IS ALL KNOWN CODES THAT WE KNOW THE ORIGIN OF, WERE CREATED BY A MIND!

    BUT ONCE YOU REPLACE THE WORD “HUMANS” WITH “MIND’, WELL WE BOTH KNOW WHAT THAT MEANS…

    Posted by PG | April 29, 2012, 12:35 am
  140. You are avoiding the question. Please provide a direct quote stating that Crick said DNA was was created. Please provide the source, otherwise what you said was purely your opinion.

    Also please provide the evidence which proves Crick was correct. Crick was an atheist which rules out a god. He made a hypothesis that aliens could have launched rockets out in to space and that those rockets brought the DNA here to Earth. He didn’t say, “Yep, aliens brought DNA here to Earth and here is my proof”.

    You argument, which you posted previously is false. My argument is at least correct in the sense the DNA code or genetic code was created by scientists to better follow/understand DNA and the chemical process. I did not agree that a god made it nor do I agree that aliens brought it to Earth.

    I now understand why so many people quit discussing the subject with you. So with that being said, I’ll give you one more chance to prove your argument or disprove mine. Either way you will need to provide factual evidence which either supports your side or disproves mine.

    Posted by PG | April 29, 2012, 10:48 pm
  141. @ NEW PG
    WHY QUOTE CRICK WHEN I CAN JUST QUOTE YOU?

    “He made a hypothesis that aliens could have launched rockets out in to space and that those rockets brought the DNA here to Earth” – NEW PG

    YOU MADE A FATAL MISTAKE AND FELL ON YOUR OWN SWORD WHEN YOU CITED CRICK AS YOUR AUTHORITY ON DNA. YOUR SUPPOSE TO BE ARGUING THAT DNA IS NOT A CODE AND LIFE ON EARTH OCCURED BY NATURAL PROCESSES, NOT BY INTELLIGENTLY ADVANCED ALIENS WHO ALTER THE DNA, PACKAGE IT, DELIVER IT IN SPACE CRAFTS. AND PURPOSELY DEPOSIT IT IN THE OCEAN!

    ONLY A COMPLETE RETRACTION OF CRICK AS YOUR APPEAL TO AUTHORITY ON DNA WILL KEEP YOU FROM COMPLETELY LOSING THIS DEBATE.

    BEST YOU MOVE ON FROM IT!…

    Posted by PG | May 1, 2012, 10:45 am
  142. “My argument is at least correct in the sense the DNA code or genetic code was created by scientists to better follow/understand DNA and the chemical process”- NEW PG

    @ NEW PG
    INCORRECT! THE GENETIC CODE HAS BEEN CODING FOR BODY PLANS WELL BEFORE MANKIND FIGURED OUT WORDS FOR IT!

    LET ME HELP YOU BETTER UNDERSTAND.
    A MORE RIGOUROUS DEFINITION OF “CODED INFORMATION” IS A SYSTEM OF SYMBOLS USED BY AN ENCODER (A “WRITER” OR “SPEAKER”) AND A DECODER ( A “READER” OR “LISTENER) WHICH TRANSMIT A MESSAGE THAT IS INDEPENDENT OF THE COMMUNICATION MEDIUM. SCIENCE OBSERVES THIS COMMUNICATION PROCESS THROUGH OUT NATURE, AND ALSO IN THE GENOME.

    SO REGARDING THE DNA COMMUNICATION PROCESS, HUMANS INVENTED WORDS FOR IT, BUT THEY DID NOT CREATE THE PROCESS, THEY DISCOVERED IT AND DECIPHERED IT!

    REGARDING THE GENETIC INFORMATION TRANSMITTING A BODY PLAN, THERE ARE CURRENTLY NO KNOWN PHYSICAL OR CHEMICAL LAWS (ON EARTH) THAT CAN ACOUNT FOR ITS ORIGIN. THUS CRICK PROPOSED THE THEORY OF DIRECTED PANSPERMIA.

    Posted by PG | May 1, 2012, 10:49 am
  143. Please provide the evidence which proves Crick was correct. Crick was an atheist which rules out a god. He made a hypothesis that aliens could have launched rockets out in to space and that those rockets brought the DNA here to Earth. He didn’t say, “Yep, aliens brought DNA here to Earth and here is my proof”.

    You are avoiding the question. Please provide a direct quote stating that Crick said DNA was was created. Please provide the source, otherwise what you said was purely your opinion.

    You argument, which you posted previously is false. My argument is at least correct in the sense the DNA code or genetic code was created by scientists to better follow/understand DNA and the chemical process. I did not agree that a god made it nor do I agree that aliens brought it to Earth.

    I now understand why so many people quit discussing the subject with you. So with that being said, I’ll give you one more chance to prove your argument or disprove mine. Either way you will need to provide factual evidence which either supports your side or disproves mine.

    Posted by PG | May 1, 2012, 6:31 pm
  144. I never said he was correct, but since you brought him up as your authority on DNA, then you must have also accepted his Directed pansprmia hypothesis, if not then regardless, it was simply really foolish of you to use him as your authority on such matters!

    Crick proposed that life on earth did not occur naturally but was an intelligent process by advanced aliens. If aliens altered dna, stored it from radiation, delivered it to earth in a space craft, and deposited it into earths primative oceans, that is a created event, not a natural occuring event!

    Get all the quotes you want here NEW PG..http://profiles.nlm.nih.gov/SC/B/C/C/P/_/scbccp.pdf

    Here is the definition of create:

    cre·ate   /kriˈeɪt, cre·at·ed, cre·at·ing, adjective
    verb (used with object)
    1. to cause to come into being, as something unique that would not naturally evolve or that is not made by ordinary processes.
    http://dictionary.reference.com/browse/create

    You lost this round!

    Best you move on to you syllogism about how man made up the word code so DNA is not a code. That a bigger fail!

    Posted by PG | May 1, 2012, 9:04 pm
  145. ooooh. No evidence that aliens came to earth to deposit DNA.
    aaaah, Now DNA isn’t code.
    weeee, keep trying.

    Posted by PG | May 3, 2012, 11:49 pm
  146. It seems that this debate is waaaaaaaaaaaaaaayy over your head. The reason why most intelligent debaters arguing that “DNA is not a code” dont ever bring up Crick is because he recieved a Noble Prize for…….. wait for it………..discovering a code! But then you really havent really shown any intelligence so far, have you!

    So here is the U.S Governments take on it!

    The National Library of Medicine, a U.S Government agency wrote:
    “The Francis Crick Papers;Defining the Genetic Coding Problem, 1954-1957”

    Here is some exerpts:

    James Watson and Francis Crick’s insight …..Watson and Crick were the first to realize that the seemingly random sequence of the four bases in DNA formed a code which specified the order of the twenty amino acids that make up most proteins

    Before their discovery of the double helix, the term genetic code had no meaning; afterwards, deciphering the code–putting together the dictionary by which the four-letter nucleic acid language is translated into the twenty-letter protein language–became the most urgent and ambitious undertaking of biologists throughout the world, an effort that defined the classical age of molecular biology.

    http://profiles.nlm.nih.gov/ps/retrieve/Narrative/SC/p-nid/153

    Posted by PG | May 4, 2012, 1:10 am
  147. Perhaps you should just explain to us more about your belief that Humans created DNA:

    LETS START WITH YOUR 4TH AND FINAL revised argument:

    P1 – All codes are created by humans
    P2 – DNA has a genetic code
    C1 – Genetic code was created by humans
    Posted by the NEW PG | April 26, 2012, 5:00 am

    Cant wait to know more about it!

    Posted by PG | May 4, 2012, 1:13 am
  148. The NEW PG says, “WAAAAAH MY PUSSY HURTS!”
    PG says, “stop playing with it so much and get a life”
    The NEW PG says, “BUT IT FEELS GOOD!”
    PG says, “ok but don’t say I didn’t warn you”.

    Posted by PG | May 4, 2012, 7:43 am
  149. This is worth repeating:to you NEW PG

    “IT SEEMS THAT I SHOVED SCIENCE SO FAR UP SOMEONES ASS THAT THEIR ONLY RESPONSE IS TO PRETEND THEY ARE ME. THAT IS THE HIGHEST FORM OF FLATTERY! EACH NEW FRAUDULENT POST PROVES JUST HOW BANKRUPT THEIR POSITION IS, AND JUST HOW RETARDED THEY REALLY ARE…

    KEEP THEM COMING DUMBSHIT, THEY ARE WONDERFUL REMINDERS OF JUST HOW MUCH I FUCKED YOU UP SO BAD!!! ”

    I LOVE IT

    Posted by PG | May 4, 2012, 9:12 am
  150. How do we know?

    Amongst other reasons, At first I thought only digitalbeach bum could be a retarded dumbshit when he proposed premise #1

    “P1 – Code is created by a humans”
    Posted by digitalbeachbum | April 10, 2012, 10:46 pm

    But then he gets his ass whooped and leaves and low and behold your dumb ass shows up with the same exact dumbshit premise!

    “P1 – All codes are created by humans”
    Posted by the NEW PG | April 26, 2012, 5:00 am

    Yeah, I shoved science up your ass so deep you have the taste of test tubes in your mouth!!! Like I said before , just take your asswooping like a man and fuck off!

    Posted by PG | May 4, 2012, 9:31 am
  151. BTW,

    “The NEW PG says, “WAAAAAH MY PUSSY HURTS!”
    Posted by (THE IMPOSTER) PG | May 4, 2012, 7:43 am

    So NEW PG, you just stated that you have a pussy!

    I agree!

    Posted by PG | May 4, 2012, 11:39 am
  152. LOL. You are one of those people who spell impostor as imposter.

    Obviously I’m the real PG and not you. You are the “NEW PG” because I’ve been posting as PG for decades. You showed up only a few weeks ago and started to post messages.

    I’m sorry you need new meds. You should call your doctor and make a return appointment.

    Posted by PG | May 4, 2012, 11:51 pm
  153. @PG
    THE ONLY MESSAGE YOU ARE SENDING TO EVERYONE BY PRETENDING TO BE ME IS THAT YOUR A ATHEIST TROLL THAT GOT YOUR ASS KICKED…

    THANK YOU!

    Posted by PG | May 5, 2012, 10:23 am
  154. No reply from you! I win! You lose! I’m a total bitchin’ rock star from Mars! I’m not normal! If you tried to borrow my brain for five seconds you’d be like, ‘Dude! Can’t handle it, unplug this bastard!’ “It fires in a way that’s maybe not from, uh… this terrestrial realm!” I kick ass! You are worthless!

    Posted by PG | May 5, 2012, 3:03 pm
  155. @NEWPG
    THE ONLY MESSAGE YOU ARE SENDING TO EVERYONE BY PRETENDING TO BE ME IS THAT YOUR A ATHEIST TROLL THAT GOT YOUR ASS KICKED…

    THANK YOU!

    Posted by PG | May 5, 2012, 3:28 pm
  156. I came back from vacation and my mailbox is filled with these ridiculous posts. Can’t people stay on the subject of DNA rather than post personal arguments?

    As for my argument, I’ve not seen any evidence which disproves that code is invented by humans and only humans. I don’t see monkeys or dolphins inventing code. Sure, they have a language but it is unknown so for now P1 is true. All code is invented by humans.

    Also, DNA has a code invented by scientists which I don’t see any evidence showing they didn’t invent it. So that makes P2 true. Which in turn makes C1 true.

    And… I’m not sure who I’m talking to now but PG your posts are unstructured and erratic. Please try to stay on the subject of DNA?

    Posted by digitalbeachbum | May 5, 2012, 10:37 pm
  157. Logic dictates that I should agree with you, but since I have no logic or common sense I will need to post a stupid reply talking about how I am right and you are wrong.

    God created DNA and all life.

    You’re probably asking yourself, “Which god?” and that is a great question!

    See, I don’t know because all religions currently in place are over 2,000 years old. The only references we have are these myths which were collected together and then bound to form when we know today as the bible. Other stories of baby jesus were discarded because they didn’t jive with the main story. Corrections and changes were made to the story to enhance the possibility of gaining followers, eventually forming what we know today as christianity.

    So knowing that chrisitanity is a bogus religion, actually all religions are bogus, it leads me to believe that aliens brought DNA here to form life, but they didn’t bring DNA and then drop it in a hot pool of lava. Nope. What they did was 75 million years ago, a leader brought billions of his people to Earth in a DC-8-like spacecraft, stacked them around volcanoes and killed them using hydrogen bombs.

    The essences (their DNA) of these many people remained, and that they form around people in modern times, causing them spiritual harm. These events are the traumatic memories known as The Wall of Fire or the R6 implant. No one can solve this problem because the R6 “implant” is “calculated to kill (by pneumonia, etc.) anyone who attempts to solve it.

    Posted by PG | May 6, 2012, 6:27 am
  158. ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^

    @NEWPG
    THE ONLY MESSAGE YOU ARE SENDING TO EVERYONE BY PRETENDING TO BE ME IS THAT YOUR A ATHEIST TROLL THAT GOT YOUR ASS KICKED…

    THANK YOU!

    Posted by PG | May 6, 2012, 11:13 am
  159. @digitalbeachbum
    “As for my argument, I’ve not seen any evidence which disproves that code is invented by humans and only humans. I don’t see monkeys or dolphins inventing code. Sure, they have a language but it is unknown so for now P1 is true. All code is invented by humans” – digitalbeachbum
    and

    THE REAL PG responds:

    Codes (A system of symbols) are all necessary components of high level communication processes!

    You just stated that monkeys and dolphins communicate, and that is correct.

    Other Examples of code in communication processes include English, Chinese, computer languages, music, mating calls and radio signals etc…

    Therefore, your “P1 – Code is created by humans” is incorrect!

    BACK TO THE DRAWING BOARD FOR YOU!!!

    .

    Posted by PG | May 6, 2012, 4:21 pm
  160. Mating calls and radio signals, no they aren’t code unless humans made them in to code.

    Code is taking an existing language, let us say English, then converting it in to a code using letters, numbers, symbols. A bird uses a language to speak to other birds of its species. They do not use code.

    In order to prove that birds created code you would need to know their full language then catch them in the act of converting their language in to a code. This is impossible for any one to figure out because no one knows how to speak bird.

    Unless you can prove that there are codes from alien life forms out of this solar system.

    Until then, P1 is correct.

    Posted by digitalbeachbum | May 6, 2012, 5:06 pm
  161. “A bird uses a language to speak to other birds of its species” – Posted by digitalbeachbum | May 6, 2012, 5:06 pm

    All languages must use agreed upon symbols (Code) or there can be no communication!

    Agreed upon symbols===> Encoder===> Message===> Decoder

    Agreed upon symbols===> Bird #1====> Message===> Bird#2

    The birds are using agreed upon symbols to communicate in their language, otherwise they couldn’t communicate!
    Therefore your P1 is incorrect!

    .

    Posted by PG | May 6, 2012, 7:35 pm
  162. So all languages must be agreed upon? Like birds held a conference and said “ok, this is what we will use and the other birds outside our species will use these calls or chirps…”. I bet that is what really happen huh? and they hold conferences every five years and review the “code” to improve or change it?

    Bird languages developed over time, before birds were birds. It wasn’t a sudden adaptation that took place in one week or a year, it took millions of years to get from point A to B to C to….

    I’ve read articles about codes being used with birds but those are only a hypothesis. It will take decades of studies, reviews and more reviews before the ornithology field will confirm that assumption. It will be more likely that those birds with “codes” aren’t actually using any agreed code among their species. It is again more likely that this language evolved over millions of years through natural selection.

    Until then P1 is correct.

    Posted by PG | May 7, 2012, 11:49 am
  163. It seems Digitalbeachbum accidently logged in as PG!

    Posted by PG | May 7, 2012, 12:03 pm
  164. So your stating that the code “Chirp” was hardwired into the birds through natural selection over millions of years..

    OK.

    The bottom line is that they are still communicating using agreed upon symbols with the chirp codes!

    Your P1 fails!

    Posted by PG | May 7, 2012, 12:08 pm
  165. Birds do not agree to speak the way that they do.

    Posted by PG | May 7, 2012, 12:27 pm
  166. Fuck you New PG! You posted on here posing as me. Your just a troll! Your to be ignored!

    Posted by PG | May 7, 2012, 1:30 pm
  167. Since digital has basically the same position, I will answer it for digital to save time.

    @digital,
    Here is your own definition of code:

    “A code is a system of words, letters, figures, or other symbols *** (CHIRPS) *** used to represent others ”

    PG responds:

    “Communication requires a system of code!” That is a requirement for there to be mutual understanding! In order for your P1 to be correct the onus is on you to prove that animals do not understand each other. Because if they do understand each other than they are using a system of symbols (code) to understand each other, and if animals are using code,

    Then your P1 is falsified!

    Posted by PG | May 7, 2012, 1:42 pm
  168. Posting the same messages for two years about the same subject I can only assume that you have limited contact with the outside world. I believe you are a worthless person who uses profanity as easily as any one else might be breathing air. Sure, keep going for another two years, but I suggest you get out of your parent’s basement every once in a while and clear out that stale air caught between your ears.

    As for me I’m done. I am really bored by your ignorance about life and your faith in your god.

    P1 is true.

    Posted by digitalbeachbum | May 7, 2012, 4:16 pm
  169. “As for me I’m done” – Posted by digitalbeachbum

    That was quick, but very much expected. The minute he showed up with a 4 term fallacy it was over before it started!

    Then proposing a Major premise P1 that as its basis states that only humans communicate with symbols therefore Humans invented the DNA code was exremely foolish to say the least. Thats what happens when you take the most extreme definition of code to exclude all other communications. In addition, trying to support that position using an excerpt out of Cricks book where they discuss why a 2 nucleotide code was incorrect and why the 3 nucleotide code was correct only backfires and proves that DNA is a 3 nucleotides code.

    “A code is a set of rules governing the order of symbols in communication. This defines a code, regardless of the nature of the symbols, be they alphabetic letters, voice sounds, dots and dashes, DNA bases, amino acids, nerve impulses, or what have you.” The Touchstone of Life: Molecular Information, Cell Communication and the Foundations of Life, by Werner R. Loewenstein, Oxford University Press, 1999

    The root and re-occuring problem here is that the Digitalbeachbums of the world will blow off the scientific evidence from Yockey and other world renowned scientists evidencing DNA code as isomorphic to Shannons communication system. Then they think IDer’s just say it was created because its just named a code. Thats a major fail!

    DNA is isomorphic to Shannon’s communication model. Therefore what Yockey and science states is true:

    “Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

    To state that DNA is not a code is anti-scientific! The current scientific and academic community universally accepts Yockey’s conclusion and acknowledge its contributions to pioneer the entire field of Bioinformatics (Biology + Information theory).

    In closing:

    “Instead, the living cell is best thought of as a supercomputer – an information processing and replicating system of astonishing complexity. DNA is not a special life-giving molecule, but a genetic databank that transmits its information using a mathematical code. Most of the workings of the cell are best described, not in terms of material stuff – hardware – but as information, or software. Trying to make life by mixing chemicals in a test tube is like soldering switches and wires in an attempt to produce Windows 98. It won’t work because it addresses the problem at the wrong conceptual level.’ – Paul Davies

    Let the digitalbeachbums of the world continue to “solder switches and wires”, but science has moved on…

    DNA is a code!

    Posted by PG | May 7, 2012, 7:43 pm
  170. DNA isn’t code.

    Posted by PG | May 8, 2012, 10:35 pm
  171. “DNA isn’t code” – NEW PG

    OK new PG. I want to be open minded about your statement that “DNA isnt code”. I am assuming that you arrived at your conclusion based on some articles or something that specified that DNA is not a code? Can you post it so i can read it?

    Posted by PG | May 8, 2012, 11:30 pm
  172. I believe that over the last two years there have been plenty of posts on this blog that give enough information that DNA is not specifically a code. Sure people like to use the word because it gives support to their delusions of a creator, but the stuff you have posted is ridiculous and I challenge any of those scientists who lay claim to it being a code.

    As it has been stated previously, DNA is a complex and wondrous part of our world, but just because you see a beautiful sunset and shout out “oh my! this sunset is so wonderful there must be a god!” or if you have amazing sex and shout out “oh god! that was amazing!” doesn’t mean there is a creator or a god.

    All religions are based on mythologies which originated during a time when humans as a whole were uneducated and ignorant. They didn’t understand how things worked so they made up shit to fill in the blanks.

    As humans we are in a stage of ignorance and lack of education on DNA. We do not fully understand how it came to be or how things fully function. Yes we know a little about it each year and we are getting more information with the genome projects and science, but we have a long way to go before we fully understand it.

    Remember history when people thought the world was flat, that the Earth was the center of the Universe, when you could get warts from frogs or that the tides were controlled by a mythical god named Poseidon? Yep, that’s happening today with DNA because people are trying to fill in the blanks with this code thing to complete their puzzle of life.

    As for DNA being a code I think it was said best in a previous post that people need DNA to be a code so it justifies their belief in a creator. It doesn’t matter who their creator is, only that they have something which by their definition is a code or language which signifies intelligence beyond human control. This gives them comfort and purpose in life; for them it is proof enough.

    This proof for them is still faith because even if DNA was actually a code it leaves a more plausible explanation for its existence. People have pointed out, even you, that “birds use code” but this doesn’t prove that there is a creator or aliens which did all the creating. It only gives support to the natural evolution of nature which after billions times billions of years can produce some very wondrous stuff.

    Posted by PG | May 9, 2012, 8:45 pm
  173. ” …but the stuff you have posted is ridiculous and I challenge any of those scientists who lay claim to it being a code” – New PG

    @PG

    The “Stuff” you are referring to are called Peer Reviewed Scientific Publications and those scientists you want to challenge are the most eminent scientists in the world. Their research opened up a field of science called Bioinformatics (Biology + Information theory). As a result, It is universally accepted by the science community that DNA is a real code! So you have a real battle on your hands, especially since you cant produce 1 single research paper to support your position!

    Your comments highlight the fact that no atheist would ever,ever, ever, openly concede that DNA is a code regardless of the fact that the overwhelming current scientific convention is that DNA is a code, and regardless of the fact that they have absolutely no science to back up their claims!

    Why?

    “In a living organism we see the power of software, or information processing, refined to an incredible degree…the problem of origin of life reduces to one of understanding how encoded software emerged spontaneously from hardware…how did nature go digital?” – Dr. Paul Davies “The fifth Miracle”

    Symbols ===>. Encoder ===> Message ===> Decoder ===>. Message used

    What we know today is that all codes that we know the ORIGIN of, only come from a mind! There are no known phyiscal laws or chemistry that can produce real information (Send messages) from an Encoder to a Decoder, using a system of symbols!

    None!

    And the implications are staggering!

    Posted by PG | May 10, 2012, 2:59 am
  174. Its July 2012, now and some very interesting new comments from the eminent scientist C. Venter and Shapiro…

    “All living cells that we know of on this planet are “‘DNA software’-driven biological machines” comprised of hundreds of thousands of protein robots, coded for by the DNA, that carry out precise functions,” said Venter. “We are now using computer software to design new DNA software.”

    “The digital and biological worlds are becoming interchangeable, he added, describing how scientists now “We are now using computer software to design new DNA software.”
    http://www.newscientist.com/blogs/culturelab/2012/07/passing-the-baton-of-life—from-schrodinger-to-venter.html

    From Shapiro we read:

    Cell Cognition and Cell Decision-Making

    “Recent postings have provoked numerous questions about my application of the term “cognitive” to cell regulatory processes. I base this usage on the notion that cognitive actions are knowledge-based and involve decisions appropriate to acquired information. It is common today for molecular, cell and developmental biologists to speak of cells “knowing” and “choosing” what to do under various conditions. While most scientists using these terms would insist they are just handy metaphors, I argue here that we should take these instinctive words more literally. Cell cognition may well prove itself a fruitful scientific concept.”
    http://www.huffingtonpost.com/james-a-shapiro/cell-cognition_b_1354889.html

    Interesting, lets see,

    We have eminent scientists saying:

    “‘DNA software’-driven biological machines” comprised of hundreds of thousands of protein robots, coded for by the DNA, that carry out precise functions,” said Dr Venter

    and

    “Cells are sentient making “Knowledge based decisions based on the acquired information” said Dr. Shapiro

    So much for the atheist/agnostic mantra of “DNA is not a code” and “evolution is “natural selection acting on random mutations”…

    Posted by PG | July 17, 2012, 12:45 am
  175. Well, Its 2012 and according to Dr C. Venter, the empirical evidence is that DNA is digital software and is thrusting science into the age of “Digital Biology”. This is horrible news for the materialists who now have to answer the question, “How did nature go digital?”

    Article #1-Passing the baton of life – from Schrödinger to Venter
    “We are in what I call the digital age of biology,”

    (Title of his Lecture)
    “All living cells that we know of on this planet are ‘DNA software’-driven biological machines comprised of hundreds of thousands of protein robots, coded for by the DNA, that carry out precise functions,”

    “We are now using computer software to design new DNA software.”

    “The digital and biological worlds are becoming interchangeable, he added, describing how scientists now simply send each other the information to make DIY biological material rather than sending the material itself. ”http://www.newscientist.com/blogs/culturelab/2012/07/passing-the-baton-of-life—from-schrodinger-to-venter.html

    Article #2 -Digitizing biology: what is life now?
    Dr Venter went on to elaborate on the rapidly diminishing distinction between biological code and digital code, making the argument that…

    “everything can be reduced to ones and zeros”.

    “I describe DNA as the software and when we activate a synthetic genome in a cell we describe it as ‘booting up’, the same way you would boot up software on a computer.”

    “We watermark DNA so that it is always possible to tell a synthetic species apart from a naturally-occurring one,”
    http://www.scienceomega.com/article/472/digitising-biology-what-is-life-now

    Article #3 -Leading geneticist heralds digital age of biology
    THE LINE separating the digital world and the biological world is blurring and may soon fade away…

    “We are in what I call the digital age of biology,”

    He repeatedly returned to his theme of the interchangability of the digital and biological worlds…

    “Life is a DNA software system,” he said. “If you change the software you change the species.”

    “The DNA itself is an analogue code, in turn converted into digital codes that in turn delivered the proteins which make things happen in the cell.”

    “I call the process digitizing biology,” he said. The DNA is the software of life, while the proteins are the hardware of life, mechanistic entities, natures robots.”
    http://www.irishtimes.com/newspaper/ireland/2012/0713/1224319967899.html

    Article #4-Rewriting the software of life
    “DNA is really just software”, says J Craig Venter, the world’s most famous genetic scientist, writes Alistair Fairweather.
    The idea of the world’s most famous genetic scientist addressing a group of computer nerds, web designers and geeks of every stripe might have seemed incongruous two decades ago. But, as J Craig Venter puts it,
    “DNA is really just software, and few people know code better than this audience.” http://mg.co.za/article/2011-03-16-rewriting-the-software-of-life/

    Article #5 -TIME:Science fiction made fact.
    Venter: “The other thing you might have thought science-fiction, there’s now little distinction between computer code and genetic code, and we readily convert one into another. So when we see what’s a genome we’re converting what we call the analogue DNA code into digital code. I’ve described that as digitizing biology.”

    “We are DNA software systems, [with] genetic code constantly driving new production of proteins. And proteins are simply robots that are chemically defined.”
    http://www.time.com/time/health/article/0,8599,2119649,00.html#ixzz217v4aTeJ

    Paul Davies asked ” How did nature go digital?”
    Many of us are asking the same question…

    Posted by PG | July 20, 2012, 1:24 am
  176. Your argument doest hold much water .. just like your comparison between dropping sodium and potassium in water and the billions of lines of information stored in DNA…also interesting is your comment about how DNA isnt special its just that ” DNA is just a very, very, very complicated molecule that happens to be capable of facilitating incredibly complex sets of chemical reaction” hmmmm your pretty good at convincing your self but the rest of us free thinking, loogical, educated, and open minded people i think not .. you fail.

    Posted by Andrew | September 13, 2012, 9:34 am
  177. Calling the methodology of the DNA molecule a simple product of chemical principles is downplaying the real phenomenon. Based on such logic, I can say that binary is nothing more than electric signals and hence, not a code. I don’t think you’d agree that binary is not a code now, would you?

    Posted by Just Saying | December 12, 2012, 2:49 pm
  178. Saying that DNA is not a code because it is enacted by chemical reactions is the same as saying that computer languages are not codes because they are enacted by electrical signals. Just the fact that the code can determine the chemical reaction and direct it to form a complex being shows that it is a code, just as computer languages control how electrical signals react with the transistors and form different electrical signals or “chemical reactions”.

    Posted by jacob | January 19, 2013, 7:07 pm
  179. Science evidences intelligent cause to DNA code…

    Title: The ‘Wow! signal’ of the terrestrial genetic code

    “Here we show that the terrestrial code displays a thorough precision-type orderliness matching the criteria to be considered an informational signal. Simple arrangements of the code reveal an ensemble of arithmetical and ideographical patterns of the same symbolic language. Accurate and systematic, these underlying patterns appear as a product of precision logic and nontrivial computing rather than of stochastic processes (the null hypothesis that they are due to chance coupled with presumable evolutionary pathways is rejected with P-value < 10-13). The patterns display readily recognizable hallmarks of artificiality, among which are the symbol of zero, the privileged decimal syntax and semantical symmetries. Besides, extraction of the signal involves logically straightforward but abstract operations, making the patterns essentially irreducible to natural origin."

    and

    In total, not only the signal itself reveals intelligent-like features — strict nucleon equalities, their distinctive decimal notation, logical transformations accompanying the equalities, the symbol of zero and semantic symmetries, but the very method of its extraction involves abstract operations — consideration of idealized (free and unmodified) molecules, distinction between their blocks and chains, the activation key, contraction and decomposition of codons. We find that taken together all these aspects point at artificial nature of the patterns.
    http://www.sciencedirect.com/science/article/pii/S0019103513000791

    CHECKMATE!

    Posted by PG | March 15, 2013, 2:56 pm
  180. If you were wondering, the above paper is Peer reviewed by the prestigious scientific journal, Icarus and was reviewed and published by the Journals board. This paper acknowledges eminent scientists Paul Davies, and Nobel laureate Manfred Eigen.

    ” We find that taken together all these aspects point at artificial nature of the patterns.”

    SWEET!

    Posted by PG | March 15, 2013, 3:00 pm
  181. I find it utterly adorable that PG would try to imply that the body of scientific evidence suggests that DNA must have been designed when, in fact, the percentage of scientists who would argue such a position is miniscule.

    And his syllogism is a great example of epically bad logic.

    1. All A are B
    2. All known B are C
    3. Therefore, all A are C

    ^ Red X, zero points, please study your logic book next time.

    Posted by MS | April 25, 2013, 11:46 am
  182. If DNA is just a chemical reaction why is that so and not nothing? It seems to me at a deeper level (that we don’t understand) there must be some code (I’m using code loosely here) which directs the reaction to occur. I believe at the deepest level the world is computational. From simple rules grows great complexity. I’m going to cut to the chase and say if we could ever understand it all, it would be code all the way down.

    Posted by Mark | July 19, 2013, 1:35 pm
  183. Great replies on here. This is the type of discussion I’ve been looking for because I’ve heard many atheists argue that DNA isn’t a code. This helps a lot.

    Since I’m more versed in philosophy and theology I wont argue one way or the other, but am interested in hearing from those whom are more knowledgeable. So this has been a great read. Thanks.

    One thing I will argue against on here, however, is the cult of personality that is now philosophical naturalism.

    Alex said:

    What we need is to force better science education in primary school. Cut them off before they can be corrupted into such stupidity in the first place. Then at least they’ll be using real science to argue, instead of “My ‘god’ did it, and you can’t prove otherwise”.

    When I was in high school science class was a joke in regard to teaching biology and Evolution. We were taught all the icons, and while there is now much to reveal about them, no one in my class was the wiser. We were brain-washed in the name of atheist’s so-called “superior education” fueled by the philosophy of Materialism.

    I could talk about this forever, but here is one good point: Around the time of Hume materialistic scientists began to make the assumption that understanding the cause and effect nature of things necessarily precludes an eternal God. Aristotle was one of the first to champion an understanding of cause and effect in nature, yet rightly understood that this understanding was only one aspect of reality. Over the last 200 years atheists have equated methodological naturalism with all of reality, and do so in accordance to their own confirmation bias of philosophical naturalism. An agnostic has said it best. “There is nothing fantastical about the idea of God.” It is atheism that is usually just as dogmatic as its counter-part, and un-cannily too much of a fulfillment of the Bible’s anthropology.

    I am all about having a respectful and intelligent conversation, and have seen this carried out on this thread so far.

    Cameron

    Posted by Cameron | July 20, 2013, 10:51 pm
  184. Is PG still around? A very fair and astute poster he has shown himself to be, makes his argument well!

    Posted by TB | February 24, 2014, 12:23 am

Trackbacks/Pingbacks

  1. Pingback: Do Bacteria Go To Heaven? « Life Without a Net - May 24, 2010

  2. Pingback: Why materialism fails to explain the genetic code - Page 32 - Parapsychology and alternative medicine forums of mind-energy.net - September 28, 2012

  3. Pingback: Why materialism fails to explain the genetic code - Page 33 - Parapsychology and alternative medicine forums of mind-energy.net - September 28, 2012

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

Follow Me On Twitter!

%d bloggers like this: